Informacija

Ką reiškia ΔC ir ΔN, kalbant apie baltymų seką?

Ką reiškia ΔC ir ΔN, kalbant apie baltymų seką?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Skaitau pranešimą apie baltymo GSK3 branduolinio eksporto reguliavimą ir susidūriau su tokiu teiginiu:

Viso ilgio FLAG epitopu pažymėtas mFrat1 (FLAG-Frat) ir Frat aminogalinė pusė (ΔC Frat) daugiausia lokalizuota transfekuotų MDCK ląstelių citoplazmoje (1 pav., A ir B, i ir iii). Netikėtai Frat (ΔN Frat) karboksilo galinė pusė daugiausia kaupėsi transfekuotų ląstelių branduoliuose (1B pav., iv).

Nesu tikras, kodėl Frat baltymo amino-galinė ir karboksilo-galinė pusė atitinkamai vadinamos ΔC Frat ir ΔN Frat. Žinau, kad baltymo amino galas taip pat vadinamas N-galu, o baltymo karboksilo galas vadinamas C-galu. Nesu tikras, kodėl šiame darbe ΔC ir ΔN vartojami norint nurodyti Frat baltymo amino-galinę ir karboksigalinę pusę.

Bet kokios įžvalgos yra vertinamos.


Frat/GBP (dažnai pertvarkytas T-ląstelių limfomose/GSK-3 surišantis baltymas) baltymas yra proto onkogenas, reguliuojantis Wnt signalizacijos kelią. (van Amerongen ir kt., 2004)

Cituotame dokumente (Franca-Koh, 2002) buvo pastebėtas ryšys tarp kai kurių Frat ir GSK3 ląstelių lokalizacijos formų. Be Frat, GSK3 yra citoplazminis. Esant Frat, heterodimeras Frat-GSK3 persikelia į branduolį. Kadangi Frat yra fosforilintas, tada buvo neaišku, koks (-i) mechanizmas (-ai) buvo susijęs (-i). Norėdami ištirti Frato vaidmenį, autoriai iškėlė hipotezę, kad gali būti įtrauktas Frat regionas, nebūtinai visas baltymas.

Jie sukūrė ištrynimo konstrukcijas ir pridėjo N-galinė FLAG žyma, skirta lengvam giminingam valymui. Ištrynimui jie naudojo simbolį delta (Δ). The N- 1–129 liekanų galinė sritis, apimanti 1 domeną, t.y. ištrynimas C-galinė sritis vadinama ΔC; taip pat, C- 129–274 liekanų galinis regionas, apimantis 2 domeną, t.y. ištrynimas N-galas vadinamas ΔN. Jie taip pat sukūrė žalio fluorescencinio baltymo (GFP) žymės sulieto baltymo variantą. Štai jų konstrukcijos, kaip parodyta jų straipsnio 1 paveiksle:

Žmogaus ortologas
Pelės Frat likučių seką suderinau su žmogaus ortologais: ji turi 79% tapatybę žmogaus Frat1 ir 68% tapatybę žmogaus Frat2. mFrat liekanos 1-129 (ΔC) ir 129-274 (ΔN) atitinka hFrat1 likučius 1-132 ir 132-279 atitinkamai.

Pridėta pastaba
Čia yra bendrakristalinė struktūra GSK3β (N-galinė skiltelė oranžinės spalvos ir C-galinė skiltelė žydros spalvos), sudaryta komplekse su Frat1 peptidu 197-226 (miško žalia) ir inhibitoriumi (N-(6-(3,4-dihidroksifenil)-1H-pirazolo[3,4-b]piridinas-3-yl)acetamidas) (žalias), kaip deponuotas RCSB kaip įrašas 5OY4.pdb . Inhibitoriaus buvimas padeda nustatyti aktyvią vietą GSK3b baltymo kinazės vaizde.

Nuorodos
Franca-Koh, J., Yeo, M., Fraser, E., Young, N. ir Dale, T.C. (2002 m.) J. Biol. Chem. 277:43844-43848.

Van Amerongen, R., van der Gulfen, H., Bleeker, F., Jonkers, J. ir Berns, A. (2004) J. Biol. Chem. 279:26967-26974.


Į Rilp panašūs baltymai Rilpl1 ir Rilpl2 reguliuoja ciliarinės membranos turinį

Pirminis ciliumas yra mikrovamzdelių struktūra, randama daugumoje žinduolių ląstelių tipų. Blakstienų funkcijos sutrikimas sukelia įvairias žmonių ligas, bendrai žinomas kaip ciliopatijos. Pranešame, kad su Rab efektoriumi susiję baltymai, sąveikaujantys su Rab lizosominiu baltymu panašus 1 (Rilpl1) ir Rilpl2, reguliuoja baltymų lokalizaciją pirminiame ciliumoje. Iš pradžių buvo nustatyta, kad Rilpl2 yra sureguliuotas pelės trachėjos epitelio ląstelėse. Rilpl1 ir Rilpl2 abu lokalizuojasi pirminėje ciliumo dalyje ir centrosomoje, o Rilpl1 – konkrečiai motinos centriolės distaliniame gale. Gyvų ląstelių mikroskopija atskleidžia, kad Rilpl2 pirminis blakstienų lokalizavimas yra dinamiškas ir kad jis yra susijęs su tubulovezikulinėmis struktūromis ciliumo apačioje. Rilpl1 ir Rilpl2 išeikvojimas lemia signalinių baltymų kaupimąsi ciliarinėje membranoje ir neleidžia tinkamai organizuoti epitelio ląstelių trimatėje kultūroje. Šie duomenys rodo, kad į Rilp panašūs baltymai veikia reguliuojant ciliarinės membranos baltymų koncentraciją, skatindami baltymų pašalinimą iš pirminio ciliumo.


Įvadas

Eukariotinėse ląstelėse išėjus iš trans-Golgi tinklo (TGN) yra du pagrindiniai keliai į lizosomą / vakuolę (Hunziker ir Geuze, 1996 Kornfeld ir Mellman, 1989). Vienas iš jų yra biosintezės kelias, kuriuo ląstelė tiekia naujai susintetintus lizosomų fermentus ir membraninius baltymus, skirtus lizosomų / vakuolių biogenezei ir palaikymui. Transporto pūslelės, gabenančios krovinio molekules, yra išaugintos iš TGN ir dažniausiai nukreiptos į endosomas prieš patekdamos į lizosomas / vakuoles. Kitas būdas yra vadinamasis endocitinis kelias, kuriuo ląstelė tiekia įvairius internalizuotus ligandus ir receptorius iš plazmos membranos (PM) į lizosomas / vakuoles skaidymui. Ligandų ir receptorių kompleksai, pavyzdžiui, EGF/EGF receptoriai, yra atskirti į vidines endosomų pūsleles (Futter ir kt., 1996). Receptorių, kurie grįžta atgal į PM, pogrupiai, tokie kaip transferino receptoriai ir mažo tankio lipoproteinų receptoriai, yra atskiriami į klatrinu padengtas pūsleles perdirbant endosomas ir pašalinami iš skilimo takų. Abiejuose keliuose endosomos atlieka pagrindinį vaidmenį rūšiuojant krovinių molekules ir iš tikrųjų endosomos yra membraninio eismo susitikimo vietos iš abiejų maršrutų.

Atlikus išsamią genetinę mielių analizę Saccharomyces cerevisiae, buvo išskirta daugiau nei 50 Vps (vacuolar protein sorting) genų, dalyvaujančių membranos transporte į vakuoles (Raymond ir kt., 1992). E klasės Vps šeima, viena iš Vps mutantų pogrupių, pasižymi nedideliu naujai susintetintos karboksipeptidazės Y (CPY), tirpaus vakuolinio fermento, sekrecijos laipsniu, palyginti su kitais Vps mutantų poklasiais. Atrodo, kad E klasės Vps mutantuose tiek 60 kDa V-ATPazės subvienetas, tiek FM4-64 dažiklis, endocitinių membranų žymeklis, kaupiasi naujuose skyriuose, esančiuose greta vakuolių, vadinamuosiuose „E klasės skyriuose“. Vienas iš E klasės Vps mutantų, vps4, kaupia vakuolinius, endocitinius ir vėlyvojo Golgi žymenis aberrantiniame daugiasluoksniame priešvakuoliniame skyriuje. Elektroninė mikroskopija atskleidė, kad, pasikeitus temperatūrai, greta vakuolių kaupiasi per didelės išlenktų cisterinių membranų krūvos. vps4ts mutantas (Babst ir kt., 1997). Šios nenormalios membranos struktūros randamos vps4 atitinka tipišką E klasės skyrių. Remiantis šiais ir kitais stebėjimais, manoma, kad Vps4p funkcija reikalinga efektyviam transportavimui iš ikivakuolinės endosomos. VPS4 genas buvo klonuotas ir nustatyta, kad jis koduoja 48 kDa baltymą, priklausantį AAA tipo ATPazių baltymų šeimai (ATPazė, susijusi su ląstelių veikla) ​​(Babst ir kt., 1998). Biocheminė Vps4p ir jo mutanto, turinčio ATP hidrolizę, analizė atskleidė, kad be nukleotidų arba su ADP surišta Vps4p forma egzistuoja kaip dimeras, o su ATP surištoje būsenoje Vps4p dimerai susirenka į dekamerinį kompleksą. Tai rodo, kad ATP hidrolizė skatina Vps4p dimerų / dekamerų surinkimo ir išmontavimo ciklą, taip pat Vps4p susiejimą su endosominiu skyriumi in vivo . Be to, VPS4 mutacijos taip pat turi įtakos dviejų kitų E klasės Vps baltymų, Vps24p ir Vps32p / Snf7p, membranų asociacijoms.

Buvo įrodyta, kad du žinduolių Vps4ps, SKD1 / Vps4B ir Vps4A, dalyvauja membranos pernešime per endosomas (Bishop ir Woodman, 2000 Yoshimori ir kt., 2000). Anksčiau mes parodėme, kad dėl SKD1 (E235Q), ATPazės trūkumo turinčios SKD1 formos (1-ojo kalio pernešimo augimo defekto slopintojo), per didelė ekspresija sukėlė įvairių membranų pernešimo per endosomas sutrikimus (Fujita ir kt., 2003). Pavyzdžiui, perdirbimo receptoriai yra kaupiami E235Q skyriuose, SKD1 (E235Q) sukeltos nenormalios endosomos. Endolino ir TGN38 perdirbimą iš PM į lizosomas ir TGN atitinkamai taip pat labai panaikina SKD1 (E235Q) ekspresija. Dėl manozės-6-fosfato receptoriaus (MPR) kaupimosi E235Q skyriuose naujai susintetintas lizosomų fermentas, katepsinas D, buvo hipersekretas į ląstelių išorę. Šie fenotipai, kuriuos lemia SKD1 (E235Q) ekspresija, buvo panašūs į tuos, kurie randami E klasės Vps mutantuose mielėse. SKD1 (E235Q) taip pat sukėlė hibridinių organelių, tarpinių membranos transportavimo skyrių tarp vėlyvųjų endosomų ir lizosomų, kaupimąsi. Nors manoma, kad SKD1 ATPazės aktyvumas yra gyvybiškai svarbus membranos transportavimui per endosomas, jo molekulinė funkcija vis dar menkai suprantama. Šiame tyrime klonavome ir apibūdinome du žinduolių E klasės Vps baltymus. Siūlome, kad jie būtų reikalingi SKD1 funkcijai transportuojant membraną per endosomas.


Ką reiškia ΔC ir ΔN, kalbant apie baltymų seką? – Biologija

Anksčiau pranešėme, kad į tabaką anksti reaguojantis į etileną genas NtER1 koduoja kalmoduliną surišantį baltymą (Yang, T. ir Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467–38473). Čia parodome, kad yra vienasNtER1 homologą, taip pat penkis susijusius genusArabidopsis. Šiuos šešis genus greitai ir skirtingai sukelia aplinkos signalai, tokie kaip ekstremalios temperatūros, UVB, druska ir žalojantys hormonai, tokie kaip etilenas ir abscizo rūgštis bei signalinės molekulės, tokios kaip metilo jazmonatas, H.2O2, ir salicilo rūgštis. Todėl jie buvo pažymėti kaip AtSR1–6 (A pasiutligėthaliana ssignalas -rreaguojantys genai). Ca 2+ /kalmodulinas jungiasi prie visų AtSR, o jų kalmoduliną surišančios sritys yra konservuotame pagrindiniame amfifiliniame α-spiralės motyve C gale. AtSR1 taikosi į branduolį ir konkrečiai atpažįsta naują 6 bp CGCG dėžutę (A/C/G)CGCG(G/T/C). Daugybinis CGCG cis-elementai randami genų promotoriuose, tokiuose kaip etileno signalizacija, abscisinės rūgšties signalizacija ir šviesos signalo suvokimas. AtSR1 DNR surišantis domenas yra 146 bp N-gale, kur visi su AtSR1 susiję baltymai turi didelį panašumą, bet neturi panašumo į kitus žinomus DNR surišančius baltymus. Kalmoduliną surišantys branduoliniai baltymai, išskirti iš sužeistų lapų, pasižymi specifine CGCG dėžutės DNR surišimo veikla. Šie rezultatai rodo, kad AtSR genų šeima koduoja kalmoduliną surišančių/DNR surišančių baltymų šeimą, dalyvaujančią daugelyje augalų signalų perdavimo takų.

Šį darbą parėmė Jungtinių Valstijų žemės ūkio departamento dotacija 2002-00741, Nacionalinio mokslo fondo dotacija MCB 96-3033 ir Nacionalinės aeronautikos ir kosmoso administracijos dotacija NAG-10-0061. Šio straipsnio publikavimo išlaidas iš dalies padengė puslapio mokesčių mokėjimas. Todėl straipsnis turi būti pažymėtas „skelbimas“ pagal 18 U.S.C. 1734 straipsnis, skirtas tik šiam faktui nurodyti.

Internetinė šio straipsnio versija (galima rasti adresu http://www.jbc.org ) yra 1 pav.

Nukleotidų seka (-os), apie kurią pranešta šiame dokumente, buvo pateikta GenBank™/EBI duomenų bankui su prisijungimo numeriu (-iais) AF506697.


Ką reiškia ΔC ir ΔN, kalbant apie baltymų seką? – Biologija

A klasės scavenger receptorius (SR-A) yra daugiafunkcis transmembraninis glikoproteinas, kuris yra susijęs su aterogeneze, įgimtu imunitetu ir ląstelių adhezija. Nepaisant išsamių receptoriaus struktūros ir funkcijų tyrimų, tarpląstelinės molekulės, kurios tiesiogiai sąveikauja su SR-A ir reguliuoja receptorių apyvartą, nebuvo nustatytos. Dabartiniame tyrime nustatėme, kad mikrotubulius surišantis baltymas Hook3 yra naujas sąveikaujantis SR-A partneris. Ryšys tarp žiurkės Hook3 izoformos ir SR-A buvo pasiūlytas atliekant mielių dviejų hibridų atranką ir SR-A-citoplazminio domeno surištų baltymų masių spektrometrinę analizę žiurkės alveolių makrofaguose. Pernelyg išreikšto ir endogeninio žmogaus Hook3 prisijungimas prie SR-A buvo įrodytas ištraukiamu tyrimu ir bendrai imunoprecipitacijomis. Be to, endogeniniai pelių SR-A ir HK3 kartu nusėdo iš ląstelių lizatų, išskirtų iš Raw264.7 pelių makrofagų ląstelių. Hook3 sąveika su SR-A buvo žymiai paskatinta po to, kai SR-A atpažino ekstraląstelinį ligandą. Tyrimai, naudojant sutrumpinimą, parodė, kad žmogaus Hook3 teigiamai įkrautas C-galo Val 614 –Ala 717 regionas buvo reikalingas sąveikai su neigiamo krūvio likučiais Glu 12 , Asp 13 ir Asp 15 žmogaus SR-A citoplazmos domene. Transfekuojant mažą trukdančią RNR, nukreiptą į Hook3, buvo žymiai padidinta bendra ir paviršiaus ekspresija, receptorių sukeltas ligandų įsisavinimas ir SR-A baltymų stabilumas, o baltymų sintezė ir brendimas nepakito. Pirmą kartą siūlome, kad Hook3 galėtų dalyvauti endocitozės pašalinimo receptorių apyvartoje.

Šį darbą iš dalies parėmė Japonijos Švietimo, mokslo, sporto ir kultūros ministerijos ir Akiyamos fondo subsidija moksliniams tyrimams. Šio straipsnio publikavimo išlaidos buvo iš dalies padengtos sumokėjus puslapių mokesčius. Todėl šis straipsnis turi būti pažymėtas „skelbimas“ pagal 18 U.S.C. 1734 straipsnis, skirtas tik šiam faktui nurodyti.

Palaikoma Welch Foundation Grant I-1300 ir Nacionalinių sveikatos institutų dotacijos NS43406.


Mazgų teorijoje tyrinėjamos mazgų „izotopijos klasės“, o tai intuityviai reiškia, kad mazgai laikomi tas pats jei vienas gali būti deformuotas į kitą neįvedant savarankiškų kirtimų (tikrasis apibrėžimas yra sudėtingesnis). Daugiakampius mazgus lengva suvokti ir jie yra patogūs kompiuteriui, nes tokio mazgo aprašymas prilygsta riboto skaičiaus koordinačių rinkiniams. Pažiūrėkite čia ir čia, kad pamatytumėte tikrus įgyvendinimus.

Kita vertus, naudoti lygius mazgus intuityviau (jūsų batų virvelės arba mazgai, kuriuos naudoja jūreiviai ir kiti, labiau primena lygius mazgus nei daugiakampius!). Tačiau visada galima pakeisti lygų mazgą daugiakampiu ir atvirkščiai, nekeičiant jo izotopijos klasės. Manau, jei pasirinksite kokią nors knygą apie mazgus, ji paaiškins, kodėl taip yra. (Išbandykite Colin Adams „Mazgų knyga: elementarus įvadas į matematinę mazgų teoriją“, daugiau pasiūlymų rasite čia.) Intuityviai apytiksliai lygiateisę funkciją apskaičiuojate pagal gabalų linijinę funkciją, atvirkščiai, jei daugiakampis mazgas yra lygus. kampus“, kad susidarytų lygus mazgas.

Taip pat žiūrėkite šį ir šiuos MSE pranešimus apie šį dvipusį ryšį.

Bet kuriuo atveju, norint atkurti išsamią informaciją apie mazgo izotopijos klasę, pakanka nubraižyti jo diagramą plokštumoje (lygią ar daugiakampę, nesvarbu) ir nurodyti, kurios sankryžos yra sankryžos, o kurios – apatinės.


Įvadas

Didelis kiekis įrodymų iš in vivo ir organelėje studijos (Cantatore ir Attardi, 1980 Montoya ir kt., 1982, 1983 Yoza ir Bogenhagen, 1984 Gaines ir Attardi, 1984a, b Gaines ir kt., 1987) nurodė, kad mechanizmas, kuriuo grindžiama 20–50 kartų didesnė rRNR geno srities ekspresija, palyginti su pasroviui esančiais genais, transkribuotais iš sunkiosios (H) mitochondrijų DNR (mtDNR) grandinės (Gelfand ir Attardi, 1981). apima skirtingą dviejų nepriklausomai kontroliuojamų persidengiančių transkripcijos vienetų aktyvumą, pradedant dviejose glaudžiai esančiose iniciacijos vietose D-kilpos regione (Montoya ir kt., 1983). Ši skirtinga dviejų transkripcijos vienetų išraiška yra ne tik reguliuojama transkripcijos inicijavimo lygiu, bet ir apima susilpnėjimo reiškinį ties 16S rRNR ir tRNR Leu (UUR) genų riba (Christianson ir Clayton, 1988 Kruse). ir kt., 1989). Pagrindinį vaidmenį šiame susilpnėjime atlieka mitochondrijų transkripcijos terminacijos faktorius (mTERF), DNR surišantis baltymas, apsaugantis 28 bp sritį tRNR Leu(UUR) geno padėtyje, esančioje šalia 16S rRNR geno ir pasroviui nuo jo. (Krusas ir kt., 1989), ši sritis apima tridekamerų seką, kuri yra labai svarbi siekiant tiksliai nukreipti užbaigimą (Christianson ir Clayton, 1988). In an in vitro transkripcijos sistemoje, naudojant mitochondrijų lizatą, nustatyta, kad mTERF skatina H grandinės transkriptų 16S rRNR – tRNR Leu (UUR) geno ribą, pradedant nuo rRNR specifinės iniciacijos vietos (Kruse). ir kt., 1989 ).

Neseniai atliktas mTERF molekulinis apibūdinimas parodė, kad jo specifinis pėdsakų formavimo aktyvumas yra susijęs su trimis su seka susijusiais polipeptidais, ty dviem ~34 kDa polipeptidais ir ~31 kDa polipeptidu, o nutraukimą skatinantis aktyvumas yra tik 34 kDa. kDa komponentai ( Daga ir kt., 1993). Funkcinio mTERF vaidmens supratimas įgijo ypatingą reikšmę po to, kai buvo įrodyta, kad A → G perėjimas mTERF apsaugoto mtDNR segmento viduryje yra susijęs su MELAS encefalomiopatija ( Goto ir kt., 1990 Kobayashi ir kt., 1990), su progresuojančia išorine oftalmoplegija (PEO) (Johns ir Hurko, 1991) ir kai kuriomis suaugusiųjų diabeto formomis (Van den Ouweland). ir kt., 1992), ir kad ši mutacija smarkiai sumažina mTERF jungimosi afinitetą su tiksline seka (Hess ir kt., 1991 Chomyn ir kt., 1992 ).

Šiame darbe mTERF cDNR buvo klonuota ir sekvenuota, o NH2- buvo nustatyti pirmtakų ir subrendusio baltymo galai. Brandus rekombinantinis baltymas, nors ir pasižymi numatomu specifiniu DNR surišimo gebėjimu, negali skatinti transkripcijos nutraukimo in vitro sistema, nurodanti kitą (-ius) komponentą (-ius), reikalingą (-ius) nutraukimo veiklai. Be to, išsami struktūros ir funkcijų analizė in vitro susintetintas mTERF pateikė įrodymų apie naują DNR surišimo motyvą, kuriame trys leucino užtrauktukai sudaro intramolekulinę trijų grandžių susuktą ritę, kuri sujungia du plačiai atskirtus pagrindinius domenus, glaudžiai susijusius su mTERF tikslinės DNR seka.


MEDŽIAGOS IR METODAI

Ląstelių kultūros

MCF10A, MCF7, MDA-MB-231 ir HEK-293T ląstelių linijos buvo įsigytos iš Amerikos tipo kultūrų kolekcijos (Manassas, VA, JAV), kur visoms ląstelių linijoms būdingas DNR pirštų atspaudų ir izofermentų aptikimas. MCF10A ląstelės buvo kultivuojamos DMEM/F12, papildytu 5% arklio serumu, 20 ng/ml EGF, 0,5 mg/ml hidrokortizono, 100 ng/ml choleros toksino, 10 mg/ml insulino ir 10 V/ml penicilino-streptomicino. . MCF7 ląstelės buvo kultivuojamos terpėje RPMI-1640 (Sigma-Aldrich, Sent Luisas, MO, JAV), papildytos 10% galvijų vaisiaus serumu (FBS ExCell Bio, Šanchajus, Kinija). MDA-MB-231 ląstelės buvo kultivuojamos L-15 terpėje (Sigma-Aldrich) su 10% FBS. HEK-293T ląstelės kultivuojamos DMEM terpėje (Sigma-Aldrich), turinčioje 10% FBS. Visos ląstelių linijos buvo auginamos 37 ° C temperatūroje su 5% CO2 išskyrus MDA-MB-231, kuris buvo auginamas 37 ° C temperatūroje be CO2.

Antikūnai ir plazmidės

Buvo naudojami šie antikūnai: antikūnai prieš E-kadheriną, N-kadheriną, vimentiną, fibronektiną, β-kateniną (BD Biosciences, San Chosė, CA, JAV), β-aktiną (Sigma-Aldrich), PRMT7, H3K4me3 (Upstate Biotechnology, Lake Placid, NY, JAV) PRMT7, YY1 (Santa Cruz Biotechnology, Dalasas, Teksasas, JAV) H4R3me2s (Active Motif, Carlsbad, CA, JAV) ir Flag-tag (Abmart, Šanchajus, Kinija).

Lentivirusinės ekspresijos plazmidės pWPXLD- konstravimui buvo panaudota 3∗flag-PRMT7 plazmidė, koduojanti 3 vėliavėle pažymėtos PRMT7 N-gales kopijas (Dr. Graydon B. Gonsalvez, Case Western Reserve universiteto, Cleveland, OH, JAV dovana). 3∗VėliavaPRMT7. Bakterijų ekspresijos plazmidės, ekspresuojančios glutationą S-transferaze (GST) pažymėtas laukinio tipo (WT) PRMT7 (pGEX-6P-1-PRMT7 WT) buvo pagamintas įterpiant PRMT7 koduojančią seką į pGEX-6P-1 vektorių rėmelyje su GST koduojančia seka. PRMT7 R531F, PRMT7 R531K ir PRMT7 Mut generavimui buvo naudojami standartiniai klonavimo metodai, kuriuose G74 ir T75 buvo mutuoti į alanino plazmides lentivirusiniuose arba bakterijų ekspresijos vektoriuose.

CRISPR / Cas9 tarpininkaujant PRMT7 išmušimas

Vieno vadovo RNR (sgRNR) prieš PRMT7 buvo sukurta naudojant CRISPRdirect įrankį (//crispr.dbcls.jp/). 20 nukleotidų seka, po kurios seka protospacerinis motyvas (PAM) 59-NGG-39, buvo naudojama kaip sgRNR pradinė seka. PRMT7 sgRNR tikslinės sekos buvo: 1 vadovas: GTCGGGCCAATCCGACCACGGGG 2 vadovas: AGTCG-GGCCAATCCGACCACGGG ir 3 vadovas: CAGTCGGGC-CAATCCGACCACGG. Visi sgRNR oligonukleotidai buvo klonuoti į lentivirusinį vektorių pLentiCRISPR, iš anksto suvirškintą BsmBI.

Virusinė infekcija

Naudoti lentiviruso pakavimo vektoriai buvo psPAX2 (Addgene, Kembridžas, MA, JAV) ir pMD2.G (Addgene). Lentiviruso generavimas HEK-293T ląstelėse ir lentivirusinių konstrukcijų transfekcija į recipiento ląstelių linijas buvo atlikta pagal gamintojo instrukcijas (Thermo Fisher Scientific, Carlsbad, CA, JAV). Transfekcijos reagentas polietileniminas (PEI) buvo įsigytas iš Sigma-Aldrich. Stabilus Vector-MCF10A, PRMT7-WT-MCF10A, PRMT7-R531K-MCF10A, Vector-MCF7, PRMT7-WT-MCF7, PRMT7-R531K-MCF7, PRMT7-WT per daug ekspresuojantis PRMT7 išmušimas (KO)-MDA-MB ir PRMT7-R531K per daug ekspresuojančios PRMT7-KO-MDA-MB-231 ląstelių linijos buvo sukurtos dėl lentivirusinės infekcijos.

RNR ekstrahavimas, atvirkštinė transkripcija ir realaus laiko RT-PGR

Bendra RNR buvo paruošta naudojant Trizol reagentų rinkinį (TaKaRa, Dalian, Kinija) pagal gamintojo instrukcijas. cDNR buvo sukurta naudojant atsitiktinius pradmenis, naudojant atvirkštinės transkripcijos sistemą (abi iš Promega, Madison, WI, JAV). Realaus laiko PGR buvo atlikta naudojant SYBR Green Realtime PCR Master Mix (CWBiotech, Pekinas, Kinija), veikiančią LightCycler 480 realaus laiko PGR sistemoje (Roche, Bazelis, Šveicarija). Pradmenų sekos buvo tokios (atitinkamai pirmyn ir atgal): β-aktinas: 59-GAGCACAGAGCCTCGCCTTT-39 ir 59-ATCCTTCTGACC-CATGCCCA-39 PRMT7: 59-GCCTATGGCTGATGCTGC -39 ir 59GA-GTTGTTG -5-ATGTTG GACAAC-AAGCCCGAATT-39 ir 59-GGAAACTCTCTCGGTCCA-39 N-kadherinas: 59-CGGGTAATCCTCCCAAATCA-39 ir 59-CTTTA-TCCCGGCGTTTCATC-39 vimentinas: TAGCC TAGCC 3 ir TAGCC GACCn: 59-GAGAACTTTGCCGCTG GATCGGTCG GTTC9 39 ir 59-TCCCTCGGAACATCAGAAAC-39.

Imunoprecipitacija ir imunoblotingas

Ląstelės buvo surinktos ir lizuojamos buferyje A [20 mM Tris-HCl (pH 8,0), 10 mM NaCl, 1 mM EDTA ir 0,5% NP-40] ir proteazės inhibitorių kokteilio tabletę (Roche Diagnostics, Indianapolis, IN, JAV) 30 min 4°C temperatūroje. Visi baltymų lizatai buvo inkubuojami per naktį su atitinkamais antikūnais, švelniai purtant 4 ° C temperatūroje, po to įpilama 40 μl Pure Proteome Protein A/G Mix Magnetic Beads (EMD-Millipore, Billerica, MA, JAV) 1 valandą kambario temperatūroje. . Karoliukai 3 kartus plaunami buferiu A, resuspenduojami 40 μl 2x pakrovimo buferyje ir virinami dar 8 min. Supernatantas buvo paveiktas SDS-PAGE, perkeltas į PVDF (EMD-Millipore) ir aptiktas ECL reagentais (GE Healthcare, Bekingemšyras, Jungtinė Karalystė).

Vėliavos pažymėto baltymo afinitetinis gryninimas

HEK-293T ląstelės buvo transfekuotos pWPXLD-3∗flagPRMT7 WT arba R531K plazmide, naudojant PEI reagentą pagal gamintojo instrukcijas. Po 48 valandų transfekcijos ląstelės buvo surinktos ir lizuojamos buferyje A, kuriame yra proteazės inhibitorių kokteilio tabletė (Roche). Visi ląstelių ekstraktai buvo inkubuojami su anti-Flag afinitetu (Biotool, Kirchberg, Šveicarija) 3 valandas 4 ° C temperatūroje, o imunoprecipitatai buvo plaunami 3 kartus 1 × Tris buferiniu druskos buferiu [50 mM Tris-HCl (pH 7,4). ) ir 150 mM NaCl). Galiausiai, surišti baltymai buvo eliuuojami 3∗ vėliavos peptidu (ApexBio, Hiustonas, TX, JAV) 1 valandą 4 °C temperatūroje.

In vitro metilinimo tyrimas ir masės spektrometrinė analizė

pWPXLD-3∗flag-PRMT7 WT/R531K (5 μg) buvo inkubuojamas vienas arba su šerdies histonais (2 μg), dalyvaujant 3H-S-adenozil-metionino (3H-SAM 15 Ci/mmol PerkinElmer, Waltham, MA, JAV) 30°C temperatūroje 1 val. Reakcija buvo sustabdyta pridedant 5x pakrovimo buferio, po to SDS-PAGE, po to gelis išdžiovinamas ir autoradiografuojamas -80 °C temperatūroje.

3∗flag-PRMT7 baltymas buvo išgrynintas iš 3∗flag-PRMT7-MCF10A ląstelių ir po to buvo išskirtas 10% SDS-PAGE. Po Coomassie briliantinio mėlynumo dažymo juosta, atitinkanti 3∗flag-PRMT7, buvo iškirpta skysčių chromatografijos-tandemo masės spektrometrijos (LC-MS/MS) analizei, atliktai Biofizikos institute (Kinijos mokslų akademija, Pekinas, Kinija).

GST išskleidžiamasis tyrimas

pGEX-6P-1, pGEX-6P-1-PRMT7-WT ir jų mutantai buvo ekspresuojami bakterijose (BL21), indukuotose 0,1 mM izopropil-β-Dtio-galaktozido (IPTG) 6 valandas 25 °C temperatūroje, o baltymai buvo išgryninti (16).

Peptidų ištraukiamieji tyrimai

Nemetilinti ir monometilinti N-galo biotinilinti peptidai, turintys 19 aa žmogaus PRMT7, BiotinRDLWRIRSPCGDCEGFDV ir Biotin-RDLWRIR (me1) SPCGDCEGFDV, buvo susintetinti GL Biochem Ltd. (Šanchajus, Kinija) ir išgryninti HPLC. Galutiniai produktai pasiekė 95% grynumą ir buvo patvirtinti elektropurškimo jonizacijos-MS (ESI-MS).

Peptidų nuleidimo tyrimas buvo atliktas, kaip aprašyta Sampath ir kt. ( 17 ).

Antikūnų, skirtų PRMT7 R531 monometilinimui, generavimas

PRMT7 R531 monometilinimo (PRMT7 R531me1) antikūnas, apimantis peptidą RDLWRIR (me1) SPCGDCEGFDV, kuris atitinka žmogaus PRMT7 baltymo 524–542 aa, buvo naudojamas triušiams imunizuoti, kad būtų sukurtas polikloninis antikūnas, aptikęs R53 monometilinimą R531 PRMT7. Antikūnui išvalyti buvo naudojamas SulfoLink imobilizacijos rinkinys peptidams (ThermoFisher Scientific).

Žaizdų gijimo, transwell migracijos ir invazijos tyrimai

Šie eksperimentai iš esmės buvo atlikti taip, kaip aprašyta Hou ir kt. ( 18 ).

Liuciferazės reporterio tyrimas

Eksperimentai buvo atlikti taip, kaip aprašyta Liu ir kt. (19). pGL4.20-E-kadherino (-420/+32) reporterio geno plazmidė buvo sukonstruota įterpiant PGR amplifikacijos produktus iš žmogaus genomo.

Chromatino imunoprecipitacija

Chromatino imunoprecipitacijos (ChIP) protokolas buvo aprašytas Wang ir kt. (20). E-kadherino promotoriaus pradmenys buvo 59-TGGTGGTGTGCACCTGTACT-39 ir 59-GACCTGCACGGTTCTGATTC-39.

Pelės plaučių metastazių tyrimas in vivo

Vector-MCF7, PRMT7-WT-MCF7 ir PRMT7-R531K-MCF7 stabilios ląstelės (2 × 106) buvo sušvirkštos į 5 savaičių amžiaus nuogų pelių BALB/c patelių uodegos venas. Po mėnesio pelėms buvo suleista 150 mg/kg D-luciferino, i.p. (GoldBio, St. Louis, MO, JAV) bioliuminescenciniam vaizdavimui. Visus eksperimentus su gyvūnais patvirtino Šiaurės rytų normalaus universiteto gyvūnų priežiūros komitetas.

Žmogaus krūties vėžio mėginiai ir imunohistochemija

Žmogaus krūties vėžio audinių mėginių mikromatricos buvo nupirktos iš Outdo Biotech (Šanchajus, Kinija). Naudotos mikroschemos buvo HBre-Duc068Bch-01, HBreD090Bc01 ir HBreD145Su02. Buvo atliktos standartinės imunohistochemijos procedūros (21).

Statistinė analizė

Duomenys pateikiami kaip vidurkiai ± SD. Statistinis reikšmingumas buvo patikrintas 2-tailed Student's t bandymai su P < 0,05, rodantis reikšmingumą. Statistinė analizė atlikta naudojant Prism programinę įrangą (GraphPad Software, La Jolla, CA, JAV) ir Image-Pro Plus, ver. 6.0 („Media Cybernetics“, Rokvilis, MD, JAV).

R531 ant PRMT7 buvo metilintas. A) In vitro metilinimo tyrimai. 3∗flag-PRMT7 baltymas, išgrynintas iš HEK-293T ląstelių, buvo inkubuojamas su šerdies histonais arba be jų, dalyvaujant 3H-SAM, o reakcijos buvo atskirtos SDS-PAGE. Metilinti baltymai buvo atskleisti autoradiografijos būdu, o bendri baltymai buvo vizualizuoti dažant Coomassie briliantiškai mėlyna spalva. Rodyklės: PRMT7 strėlių antgaliai: pagrindiniai histonai. B) PRMT7 afininis gryninimas. PRMT7-WT-MCF10A ir VectorMCF10A ląstelės buvo naudojamos vėliava pažymėtam PRMT7 baltymui išgryninti anti-Flag afiniteto geliu. Eliuatai buvo atskirti SDS-PAGE ir vizualizuoti Coomassie briliantiškai mėlynu dažymu. Rodyklės: PRMT7. C) Masių spektrometrinė analizė. Išgrynintas PRMT7 iš MCF10A ląstelių buvo analizuojamas in vivo metilinimas. Metilinta R531 liekana buvo nustatyta IR # SPCGDCEGFDVHIMDDMIK PRMT7 fragmentacijoje. D) PRMT7 baltymų sekų derinimas tarp žinduolių. Likutis R531 pozicijoje H. sapiens yra nurodyta aukščiau ir paryškinta raudonai baltymų sekose.


Ką reiškia ΔC ir ΔN, kalbant apie baltymų seką? – Biologija

Wnt signalizacija atlieka lemiamą vaidmenį nukreipiant ląstelių diferenciaciją, poliškumą ir augimą 1, 2, 3. Kanoniniame kelyje Wnt receptoriai aktyvuoja Disheveled (Dvl), o tai blokuoja pagrindinio signalo keitiklio, β-katenino, skaidymą. β-katenino branduoliniam kaupimuisi ir Wnt tikslinių genų indukcijai per TCF/LEF šeimos transkripcijos faktorius 1, 2, 3. Čia mes nustatėme naują zebrafish geną, koduojantį Ccd1, kuris turi DIX (Di shevelled-A x in) domeną. . DIX domenai yra būtini dviejų pagrindinių Wnt pasroviui skirtų tarpininkų, Dvl ir Axin, signalo perdavimui. Ccd1 sudarė homomerinius ir heteromerinius kompleksus su Dvl ir Axin ir aktyvavo nuo TCF priklausomą transkripciją in vitro . Be to, per didelė raiška ccd1 zebrafish embrionuose sumažino akių ir priekinių smegenų dydį (pasteriorizaciją), kaip matyti wnt8 perdėta išraiška 4, 5, 6, o dominuojanti neigiama ccd1 (DN-ccd1) sukėlė priešingą fenotipą. Be to, Wnt aktyvacijos fenotipas, kurį sukelia ccd1 buvo slopinamas išraiška aksinas1 arba DN-ccd1, ir wnt8 per didelės ekspresijos fenotipą išgelbėjo DN-ccd1, o tai rodo, kad Ccd1 veikia pasroviui nuo Wnt receptoriaus ir prieš Axin. Šie rezultatai rodo, kad Ccd1 yra naujas teigiamas reguliatorius šiame Wnt signalizacijos kelyje zebrafinių nervų modeliavimo metu.


Išplėstiniai duomenys 1 pav. Sąveika BRIL–δOR(ΔN/ΔC)–naltrindolio ortosterinėje ligandų surišimo vietoje.

a, „Iš arti“ vaizdas į vandenilio jungčių sąveikos tinklą (geltonos punktyrinės linijos) tarp ligando naltrindolio (oranžinės lazdelės) ir receptoriaus (žalios animacinio filmo šoninės grandinės rodomos kaip lazdelės), rodantis vandens (raudonų sferų) sukeltą sąveiką. b, Vandens sukeltų sąveikų (pilkų punktyrinių linijų) BRIL-δOR (ΔN / ΔC) – naltrindolo ortosterinėje kišenėje apžvalga. c, mFoDFc „Praleisti“ elektronų tankio žemėlapį (mėlynas tinklelis) aplink naltrindolį (oranžinės lazdelės) po imituoto atkaitinimo PHENIX 41 (5 000 K kontūras esant 3σ) rodomos visos ortosterinėje vietoje esantį ligandą supančios vandens molekulės (raudonos sferos). d, BRIL-δOR (ΔN / ΔC) – naltrindolio (žalias paviršius) paviršiaus vaizdas, rodantis naltrindolio (oranžinės lazdelės) ir vandens telkinio (raudonos sferos) padėtį ortosterinėje vietoje.

Išplėstiniai duomenys 2 pav M. musculus ir žmogaus δ-OR receptorių struktūros.

a, Žmogaus BRIL-δOR(ΔN/ΔC)-naltrindolo struktūros (žalios) palyginimas su anksčiau nustatyta 3,4 Å kristalų struktūra M. musculus δOR-T4L (rausvai raudona PDB 4EJ4). Ligandas naltrindolis BRIL – δOR (ΔN / ΔC) – naltrindolo struktūroje rodomas kaip oranžinės sferos ir yra praleistas 4EJ4 struktūroje. Vandens molekulės ir natrio jonai BRIL-δOR (ΔN / ΔC) – naltrindolo struktūros allosterinėje vietoje yra atitinkamai parodyti kaip raudonos ir mėlynos sferos. Pilka dėžutė žymi apytiksles receptoriaus 7TM domeno sritis, įterptas į lipidines dvisluoksnes geltonas lazdeles, žymi lipidus. ICL3 sulietas baltymas 4EJ4 (T4L) ir N-galinis BRIL sulietas baltymas BRIL-δOR (ΔN/ΔC) – naltrindolo struktūrose yra praleistas. b, žmogaus δ-OR konformacija ECL3 ir palyginimas su pelės δOR – T4L ECL3 struktūra. BRIL–δOR(ΔN/ΔC) – naltrindolis rodomas kaip žalias animacinis filmas, o šoninės grandinės vaizduojamos kaip žalios lazdelės. Ligandą naltrindolį vaizduoja oranžinės anglies lazdelės ir skaidrios sferos (BRIL-δOR (ΔN/ΔC) – naltrindolo struktūra) ir rausvai raudonos anglies lazdelės (4EJ4 struktūra).

Išplėstiniai duomenys 3 pav. Allosterinės kišenės išsaugojimas A klasės GPCR, kuriuose yra natrio jonų ir vandens spiečius.

a, Structural comparison of the sodium pocket between BRIL–δOR(ΔN/ΔC)–naltrindole structure (green cartoon and carbon atoms) and sodium-bound 1.8 Å resolution structure of A2AAR (PDB 4EIY yellow cartoon and carbons). Water molecules of the pocket in the δ-OR structure are shown by red transparent spheres and smaller solid spheres, whereas water molecules in the A2AAR structure pocket are shown with small yellow solid spheres only. Sodium ions in both structures are shown with blue transparent spheres, with red dotted lines from the Na + ion to the five coordinating oxygen atoms shown in the δ-OR structure. Part of the ligand naltrindole is shown as thick sticks with orange carbons. The comparison reveals identical side chains and similar conformations in 15 residue positions of the pocket. The important exception is the 3.35 position that in δ-OR features a polar Asn 131 3.35 side chain coordinating the Na + ion, whereas in A2AAR the Leu 87 3.35 side chain is oriented towards the lipidic membrane. b, Sequence comparison of the allosteric sodium pocket residues in currently available crystal structures of class A GPCRs. Asterisk marks receptors with high-resolution crystallographic evidence for sodium ions coordinated by the D 2.50 side chain. Note that rhodopsin (OPSD) lacks polar residues in key positions 3.39, 7.45 and 7.46, which sets it apart from other class A receptors.

Extended Data Figure 4 Electron density maps around the δ-OR sodium-binding site.

a, 2mFoDFc electron density map (grey mesh) of receptor residues (cyan sticks) around the sodium ion (blue sphere)-binding site contoured at 1σ. Black dashed lines represent interactions between the sodium ion and the atoms in direct contact with the receptor residues or water molecules in the first hydration shell of the ion. Yellow dashed lines show the hydrogen-bond network of water molecules and receptor residues. These polar interactions in the core of the 7TM bundle of the receptor establish an axis of connectivity between the orthosteric binding site, allosteric sodium site and residues in the intracellular side of the receptor. b, mFoDFc ‘omit’ electron density map of sodium ion and coordinating water molecules after simulated annealing in PHENIX 41 (5,000 K contoured at 3σ).

Extended Data Figure 5 Functional characterization of wild-type δ-OR and the engineered BRIL–δOR(ΔN/ΔC) construct used for crystallization.

a, b, G-protein signalling characterization for wild-type (a) and BRIL–δOR(ΔN/ΔC) (b) is shown. Allosteric inhibitory effect of sodium on DADLE binding to 3 H-naltrindole-labelled wild-type δ-OR expressed in HEK293 cells (positive control) (c) and the BRIL–δOR(ΔN/ΔC) construct used for crystallization and expressed in Sf9 cells (d). Ligand-binding data (d) were analysed using the allosteric model, and the results are shown in Table 1. Data represent the mean of four independent experiments each in quadruplicate.