Informacija

6.2.1. Genų raiška evoliucijoje – biologija

6.2.1. Genų raiška evoliucijoje – biologija



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Mokymosi tikslai

  • Naudodamiesi pavyzdžiais, apibūdinkite, kaip genų ekspresijos pokyčiai gali būti susiję su fenotipo ir evoliucijos pokyčiais.

Mutacijos gali atsirasti abiejuose cis- elementai ir trans-faktoriai; abu gali sukelti pakitusius genų ekspresijos modelius. Jei pakitęs genų ekspresijos modelis suteikia selektyvų pranašumą (arba bent jau nesukelia didelio trūkumo), jie gali būti atrinkti ir išlaikyti būsimose populiacijose. Jie netgi gali prisidėti prie naujų rūšių evoliucijos. Stipriklio sekos pakeitimo pavyzdys pateiktas Pitx genas.

Pavyzdys: Pitx išraiška Stickleback

Trispyglius snukis pateikiamas natūralios mutacijos atrankos pavyzdys a cis-reguliacinis elementas. Ši žuvis būna dviejų formų: (1) populiacijos, kurios gyvena giliuose, atviruose vandenyse ir turi dygliuotą dubens peleką, kuris atgraso didesnes plėšrūnes žuvis nuo jomis maitintis; (2) populiacijos iš seklios vandens aplinkos ir neturinčios šio dubens peleko. Atrodo, kad sekliame vandenyje ilgas, spygliuotas dubens pelekas būtų trūkumas, nes jis dažnai liečiasi su nuosėdomis tvenkinio dugne ir leidžia nuosėdose esantiems parazitiniams vabzdžiams įsiveržti į lazdelę. Tyrėjai palygino individų genų sekas tiek iš gilių, tiek iš seklių vandens aplinkos. Jie pastebėjo, kad giliavandenių populiacijų embrionuose genas vadinamas Pitx buvo išreikštas keliose ląstelių grupėse, įskaitant tas, kurios išsivystė į dubens peleką. Išreikšti embrionai iš seklių vandens populiacijos Pitx tose pačiose ląstelių grupėse kaip ir kita populiacija, su svarbia išimtimi: Pitx nebuvo išreikštas dubens peleku pirmapradis sekliųjų vandenų populiacijoje. Tolesnė genetinė analizė parodė, kad nėra Pitx genų ekspresija iš besivystančio sekliųjų vandenų sėlinuko dubens peleko atsirado dėl to, kad prieš srovę nebuvo tam tikro stipriklio elemento (mutacijos). Pitx.

Paveikslas (PageIndex{1}): Didelio, spygliuoto dubens peleko išsivystymas giliavandenių spygliuočių nugaroje (kairėje) priklauso nuo konkretaus sustiprintojo elemento buvimo prieš geną, vadinamą Pitx. Mutantai, kuriems trūksta šio elemento, taigi ir didelio dubens peleko (dešinėje), buvo atrinkti sekliuose vandenyse. (Wikipedia-Richard Wheeler-GFDL)

Galvoju apie mutaciją

Apsvarstykite stipriklio elementą, mutavusį sekliuose vandenyse esančiose lazdelėse:

Kokia tos DNR sekos funkcija? Kokio tipo baltymai ten jungtųsi?

Ar manote, kad ši mutacija veikia dominuojančiai ar recesyviai?

Kuris iš šių procesų yra paveiktas mutacijos: DNR replikacija, transkripcija, sujungimas ir (arba) transliacija?

Ar būtų įmanoma, kad kita mutacija pakeistų šios mutacijos ir sekliųjų vandenų snukio su ilgu peleku padarinius?

Pavyzdys: Hemoglobino ekspresija placentos žinduoliuose.

Hemoglobinas yra raudonųjų kraujo kūnelių (eritrocitų) deguonį pernešantis komponentas. Hemoglobinas paprastai egzistuoja kaip keturių nekovalentiškai surištų hemoglobino molekulių tetramerai. Kiekviena hemoglobino molekulė susideda iš a globinas polipeptidas su kovalentiškai prijungta hemo molekule. Hemas gaminamas per specializuotą medžiagų apykaitos kelią, o vėliau sujungiamas su globino polipeptidu modifikacija po vertimo.

Vystymosi metu tetramerų sudėtis keičiasi. Nuo ankstyvos vaikystės dauguma tetramerų yra (mathbf{alpha}) tipo2(mathbf{eta})2, o tai reiškia, kad juose yra dvi kiekvienos iš dviejų šiek tiek skirtingų globino baltymų, pavadintų (alpha) ir (eta), kopijos. Nedidelis suaugusiųjų hemoglobino kiekis yra (alfa)2(delta)2, kuriame yra (delta) globinas vietoj įprastesnio (eta) globino. Prieš gimimą vyrauja kiti tetrameriniai deriniai: (zeta)2(varepsilon)2 gausiausia embrionuose ir (alpha)2(gamma)2 gausiausia vaisiuose. Nors šeši globino baltymai ((alpha) = alfa, (eta) = beta, (gamma) = gama, (delta) = delta, (varepsilon) = epsilonas , (zeta) = zeta) yra labai panašūs vienas į kitą, jų funkcinės savybės šiek tiek skiriasi. Pavyzdžiui, vaisiaus hemoglobino afinitetas deguoniui yra didesnis nei suaugusiojo hemoglobino, todėl vaisius veiksmingiau išskiria deguonį iš motinos kraujo. Specializuoti (gamma) globino genai, būdingi vaisiaus hemoglobinui, randami tik placentos žinduoliams.

Paveikslas (PageIndex{3}): Globino genų ekspresija prenatalinio ir postnatalinio vystymosi metu žmonėms. Taip pat nurodomi organai, kuriuose globino genai pirmiausia išreiškiami kiekviename vystymosi etape. (Origianl-Deyholos-CC:AN)

Kiekvieną iš šių globino polipeptidų koduoja skirtingas genas. Žmonėms globino genai yra išsidėstę dviejose chromosomose ((PageIndex{4}) pav.). Galime daryti išvadą, kad šios klasteriai atsirado dėl daugybės protėvių globino geno dubliavimosi. Genų dubliavimas įvykiai gali atsirasti dėl retų procesų klaidų, tokių kaip DNR replikacija, mejozė ar perkėlimas. Pasikartojantys genai gali kaupti mutacijas nepriklausomai vienas nuo kito. Mutacijos gali atsirasti reguliuojančiose srityse (pvz., promotoriaus regionuose), arba koduojančiose srityse, arba abiejose. Tokiu būdu globino genų promotoriai išsivystė, kad būtų išreikšti skirtingose ​​vystymosi fazėse ir gamintų baltymus, optimizuotus prenatalinei aplinkai.

Paveikslas (PageIndex{4}): Žmogaus 11 ir 16 chromosomos fragmentai, kuriuose yra atitinkamai į (eta) ir (alpha) panašių goblinų genų sankaupos. Kai kurie tyrinėtojai taip pat aprašė papildomus globino genus (( heta), (mu)), bet čia jie neparodomi. (Origianl-Deyholos-CC:AN)

Žinoma, ne visos mutacijos yra naudingos: kai kurios mutacijos gali sukelti vieno ar kelių genų dubliavimosi produktų inaktyvavimą. Tai gali sukelti tai, kas vadinama a pseudogenas. Pseudogenų ((psi)) pavyzdžiai taip pat randami globinų klasteriuose. Pseudogenai turi mutacijų, kurios neleidžia jiems išvis pasireikšti. Globino genai yra pavyzdys, kaip genų dubliavimas ir mutacija, o vėliau atranka, leidžia genams vystytis specializuotiems ekspresijos modeliams ir funkcijoms. Daugelis genų išsivystė kaip genų šeimos tokiu būdu, nors jie ne visada susitelkę, kaip ir globinai.

Pratimas (PageIndex{1})

Asmenys, sergantys tokiomis ligomis kaip pjautuvo pavidalo ląstelių liga arba (eta)-talasemija, turi mutacijų, kurios sukelia netinkamą baltymo formavimąsi arba HBB (beta-globino) baltymo nebuvimą. Kaip suprasti normalią kitų hemoglobino baltymų ekspresiją galėtų padėti sukurti naujus gydymo būdus šiems pacientams? Kokie įrankiai ir procesai gali būti naudojami?

Atsakymas

Naujausi klinikiniai tyrimai tiria galimybę naudoti genų redagavimą vaisiaus hemoglobino ekspresijai pacientams, sergantiems pjautuvinėmis ląstelėmis ir beta talesemija. Šis procesas išskiria iš pacientų kamienines ląsteles, redaguoja DNR in vitro, o tada persodinamos redaguotos ląstelės atgal į pacientą (peržiūrėta https://academic.oup.com/hmg/advance-article/doi/10.1093/hmg/ddaa088/5836961).

Naujienų ataskaita apie vieną iš šių pacientų yra šioje nuorodoje https://www.npr.org/sections/health-shots/2020/06/23/877543610/a-year-in-1st-patient-to-get- genų redagavimas pjautuvinių ląstelių ligai klesti.

Pasirinktos nuorodos:

Ye L, Wang J, Tan Y ir kt. (2016) Genomo redagavimas naudojant CRISPR-Cas9, siekiant sukurti HPFH genotipą HSPC: pjautuvinių ląstelių ligos ir β-talasemijos gydymo metodas. Proc Natl Acad Sci U S A. 2016;113(38):10661-10665. doi:10.1073/pnas.1612075113 (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5035856/)

Weber L, Frait G, Felix T ir kt. (2020) Redaguojant γ-globino represoriaus surišimo vietą atkuriama vaisiaus hemoglobino sintezė ir pataisomas pjautuvo pavidalo ląstelių ligos fenotipas. Mokslo pažanga 2020 m. vasario 12 d. (https://advances.sciencemag.org/content/6/7/eaay9392?utm_source=TrendMD&utm_medium=cpc&utm_campaign=TrendMD_1)

Demirci S, Leonard A, Tisdale JF. (2020) Genomo redagavimo strategijos vaisiaus hemoglobino indukcijai sergant beta hemoglobinopatija. Žmogaus molekulinė genetika 2020 m. gegužės 14 d. https://doi.org/10.1093/hmg/ddaa088


Įdėtųjų genų struktūrų evoliucija ir funkcinė reikšmė Drosophila melanogaster

Beveik 10% genų genome Drosophila melanogaster yra įdėtose struktūrose, kuriose vienas genas yra visiškai įdėtas į kito geno introną (atitinkamai įdėtas ir įskaitant geną). Nors šių įdėtųjų / įskaitant genų poras koduojančios sekos ir neišverstos sritys nesutampa, jų intymios struktūros ir bendrų reguliavimo sekų galimybė kelia klausimų dėl evoliucinių jėgų, valdančių šių struktūrų atsiradimą ir vėlesnį funkcinį bei evoliucinį poveikį. Šiame tyrime parodome, kad įdėtieji genai patiria silpnesnį evoliucinį suvaržymą, turi greitesnį baltymų evoliucijos greitį ir yra išreikšti mažiau audinių nei kiti genai, o įskaitant genus, jie rodo priešingus modelius. Stebėtina, kad nepaisant visiškai sutampančių vienas su kitu, įterptieji ir įskaitant genus mažiau tikėtina, kad jie parodys koreliuojamą genų ekspresiją ir biologinę funkciją nei netoliese esantys, bet nesutampantys genai. Įdomu tai, kad daug mažiau įdėtų genų yra perrašoma iš tos pačios grandinės kaip ir genas. Mes nustatėme, kad tos pačios grandinės lizdiniai genai labiau tikėtina, kad yra vieno egzono genai. Be to, mažiau tikėtina, kad tos pačios grandinės, įskaitant genus, žinomi mirtini ar sterilūs fenotipai nei priešingos grandinės, įskaitant genus, tik tada, kai atitinkami įdėtieji genai turi intronus. Šie rezultatai patvirtina mūsų hipotezę, kad atranka nuo galimo klaidingo mRNR susiliejimo, kai įdėtas ir įskaitant genus yra toje pačioje grandinėje, vaidina svarbų vaidmenį įdėtųjų genų struktūrų evoliucijoje.

Genų pasiskirstymas genome nėra atsitiktinis. Yra regionų, kuriuose yra nedaug funkcinių genų, ir regionų, kuriuose genai yra tankiai supakuoti. Buvo žinoma, kad genų artumas gali turėti reikšmingų funkcinių pasekmių. Iš tiesų, buvo įrodyta, kad kaimyniniai genai turi koreliuojančius ekspresijos modelius eukariotuose (įskaitant mieles [Cohen ir kt., 2000], Caenorhabditis elegantiškas [Lercher ir kt. 2003], Drosophila [Boutanaev ir kt. 2002], Arabidopsis thaliana [Williams ir Bowles 2004] ir žmonės [Lercher ir kt. 2002 Trinklein ir kt. 2004]), taip pat biologines funkcijas ir (arba) signalizacijos kelius (Elo ir kt., 2003, Lee ir Sonnhammer, 2003, Al-Shahrour ir kt., 2010). Ekstremaliais atvejais atstumas tarp gretimų genų yra 0, o dalis arba visos jų genų struktūros (egzonai, intronai arba neverčiamos sritys [UTR]) persidengia viena su kita (persidengę genai). Šios struktūros dažniausiai stebimos eukariotuose (pvz. C. elegans [Chen ir Stein 2006], Drosophila [Misra ir kt. 2002], ir žinduoliai [Veeramachaneni ir kt. 2004]).

Ypač įdomi sutampančių genų klasė yra ta, kai vienas genas yra visiškai įdėtas į kito geno introną (atitinkamai įdėtas ir įskaitant geną [apžvelgta Kumar 2009]). Nors šių įdėtųjų / įskaitant genų poras koduojančios sekos nesutampa, jų intymios struktūros kelia klausimų apie evoliucines jėgas, valdančias įdėtųjų genų struktūrų atsiradimą ir jų vėlesnį funkcinį bei evoliucinį poveikį. Mes nustatėme, kad Drosophila melanogaster, maždaug 16 % genų (2 295 iš 14 072 genų) sutampa su bent vienu kitu genu egzonuose, intronuose arba UTR. Įdėtose struktūrose esantys genai sudaro 9,5 proc D. melanogaster genų (1 338 genai), o tai yra daugiau nei C. elegans (2,7 proc., Chen ir Stein 2006) ir žmogaus (2,73 proc., Yu et al. 2005). Išnagrinėti įdėtųjų genų struktūrų evoliucinę ir funkcinę reikšmę D. melanogaster Kontroliuodami arti esančių genų būdingus požymius, palyginome įdėtąsias / įskaitant genų poras su “valdymo genų poromis,” kurių chromosomų pasiskirstymas atitinka įdėtųjų / įskaitant genų poras ir yra 500 bp atstumu viena nuo kitos, bet nepersidengti (žr. Medžiagos ir metodai).

Mutacinė įvestis yra pagrindinis įdėtųjų genų vietą lemiantis veiksnys

Ankstesnė analizė parodė, kad dauguma įdėtų genų struktūrų Drosophila atsirado dėl intronų koduojančių sekų intarpų arba de novo atsiradimo (Assis et al. 2008). Didesni intronai yra didesni įterpimo ar de novo mutacijų taikiniai ir turėtų būti labiau linkę turėti įdėtus genus. Iš tiesų, mes nustatėme, kad bendras intronų ilgis įtraukiant genus yra žymiai ilgesnis nei kontrolinių genų, net ir atmetus seką, kurią sudaro įdėtieji genai (mediana: 12 183 [įskaitant] ir 308 [kontrolę] Mann–Whitney U bandymas (MWU) P < 10 � ). Įskaitant genus taip pat yra daugiau intronų nei įdėtieji genai ir kontroliniai genai (mediana: 7 [įskaitant], 2 [kontrolė] ir 1 [įdėtas] MWU, P < 10 − 16 abiem palyginimams). Sutelkiant dėmesį į genų įtraukimą, intronai su įdėtais genais yra žymiai ilgesni nei intronai be įdėtų genų (mediana: 4 826 [su įdėtais genais] ir 138 [be įdėtųjų genų] MWU, P < 10 − 16 ). Kadangi buvo nustatyta, kad ilgi intronai yra labiau evoliuciškai konservuoti ir labiau tikėtina, kad juose yra funkcinės sekos (Haddrill ir kt., 2005), šis stebėjimas mažai tikėtinas, nes didesni intronai yra labiau tolerantiški įterpimams. Be to, D. melanogasterD. simulans ilgiausių įtraukiančių genų intronų skirtumai yra mažesni nei kitų įtraukiančių genų intronų, net ir atmetus įdėtus genus (mediana: 0,071 [ilgiausias] ir 0,082 [kitas] MWU testas, P = 0, 0012), o tai rodo, kad ilgų intronų, kurie yra labiau evoliuciškai konservuoti, stebėjimas neatsiranda dėl dalies juose esančių genų. Šie rezultatai patvirtina, kad mutacijos procesas yra pagrindinis įdėtų genų vietą lemiantis veiksnys.

Atranka vaidina svarbų vaidmenį palaikant ir funkcinę reikšmę įdėtųjų genų struktūroms

Kelios hipotezės, galinčios paaiškinti selektyvų spaudimą, turintį įtakos įdėtųjų struktūrų fiksavimui populiacijoje ir jų vėlesnei funkcinei evoliucijai, pateikia konkrečias prognozes apie dabartines įdėtųjų ir įskaitant genų ekspresines ir funkcines koreliacijas. Be bendros chromosomų aplinkos, kuri galėjo lemti koreliuojamą arti esančių genų ekspresiją (apžvelgta Hurst ir kt., 2004, Oliver ir Misteli, 2005), genai, esantys įdėtose struktūrose, gali būti selektyviai palankūs, jei jų ekspresija ir (arba) biologinės funkcijos yra bendrai reguliuojamos. , todėl dar stipresnė teigiamai koreliuojama ekspresija ir (arba) biologinės funkcijos nei kaimyniniai genai. Kita vertus, įdėtųjų ir įtraukiančių genų artumas gali sukelti trukdžius transkripcijos metu, o tai lemia atranką prieš erdviniu ir laiku koreliuojamą įdėtųjų ir įskaitant genus (“transcriptional interference” [Shearwin ir kt., 2005 Liao ir Zhang 2008). ]). Vis dėlto įdėtųjų genų struktūrų evoliucija gali būti beveik neutralus procesas (Lynch ir Conery 2003 Lynch 2006), o įdėtų ir įtrauktų genų ekspresija ir funkcinės koreliacijos būtų panašios į arti esančių genų.

Įdėtos / įskaitant genų poros yra reikšmingai teigiamai koreliuojamos (apskaičiuota naudojant Spearman rangą ρ) genų ekspresijos lygiuose audiniuose (FlyAtlas, Chintapalli ir kt., 2007, MWU, P = 0,025). Tai taip pat pastebima kontrolinių genų poroms (MWU, P < 2 × 10 − 16 ]. Tačiau koreliacijos tarp įdėtųjų / įskaitant genų poras yra žymiai silpnesnės (Spearman rangas ρ mediana 0,019 [įdėta / įskaitant genų poras] vs. 0,174 [kontrolinių genų poros], MWU, P = 8.6 × 10 − 14 , pav. 1) ir mažiau tikėtina, kad bus teigiamas (52,74 % [įdėtas / įskaitant genų poras], palyginti su. 69,44 % [kontrolinių genų poros] Fišerio tikslus testas [FET], P = 4 × 10 − 9 ) nei kontrolinių genų poros. Tiesą sakant, įdėtųjų/įskaitant genų porų ekspresijos koreliacijos nesiskiria nuo dviejų atsitiktinai parinktų genų, kurie yra ne gretimi, bet yra toje pačioje chromosomoje (“random control geno pairs” Spearman rangas ρ mediana 0,019 [įdėta / įskaitant genų poras] vs. 0,032 [atsitiktinės kontrolės genų poros] MWU, P = 0,76, pav. 1). Be to, panaudojome logistinę regresiją ir nustatėme, kad įdėtosios/įskaitant genų poros yra mažiau linkusios nei kontrolinės genų poros turėti vieną geną (įdėtas įdėtas genas/įskaitant genų poras), kuris bus išreikštas kito geno audinių pogrupyje (įskaitant įdėtos/įskaitant genų poras P = 0,05 šansų santykis = 0,78), kad audiniai būtų tokie patys didžiausi (P = 8 × 10 − 11 šansų santykis = 0,25) ir turi būti susietas su tomis pačiomis GO (genų ontologijos) kategorijomis (P = 0,002, 0,001, 0,02 šansų santykis = 0,14, 0,17, 0,16 atitinkamai biologiniam procesui, molekulinei funkcijai ir ląstelių komponentui). Tačiau vėlgi, kai palyginome įdėtas / įskaitant genų poras su atsitiktinės kontrolės genų poromis, nė vienas iš šių trijų skirtumų nebuvo reikšmingas. Įdėtų/įskaitant genų porų išraiškos modelių ir dalyvavimo biologinėse funkcijose koreliacijos labai skiriasi nuo to, kas buvo pastebėta šalia esančių nesutampančių genų atveju, o tai rodo, kad atranka prieš transkripcijos trukdžius galėjo lemti jų ekspresiją skirtinguose audiniuose ir dalyvavimą įvairiose biologinėse funkcijose. .

Spearman platinimai ρ genų ekspresijoje įdėtoms/įskaitant genų poras ir kontrolinių genų poras. Įdėtos / įskaitant genų poros yra mažiau teigiamai koreliuojamos savo ekspresijos lygiu 20 audinių nei kontrolinių genų porų, tačiau turi panašią ekspresijos koreliaciją su negretimomis toje pačioje chromosomoje esančių genų poromis (“random kontrolinių genų poros”).

Tos pačios krypties įdėtos / įskaitant genų poras trūkumas gali atsirasti dėl atrankos prieš sujungimą

Įdėtieji genai gali būti transkribuoti iš tos pačios grandinės kaip ir juos apimantys genai (ta pati grandinė) arba skirtingos grandinės nuo juos apimančių genų (priešinga grandinė). Nustatyta, kad dauguma įdėtų genų (71,27%) yra priešingoje grandinėje. Ši proporcija labai skiriasi nuo kontrolinių genų porų dalies (53,55%) ir nuo numatomos proporcijos, jei orientacijos yra atsitiktinės (50% FET, P < 10 − 16 abiem palyginimams). Nors įdėtųjų genų grandinės paklaidos buvo plačiai aprašytos skirtinguose eukariotuose (63% tos pačios grandinės įdėtų genų žmonėms [Yu ir kt., 2005] ir 88% C. elegans [Chen ir Stein 2006]), biologinė šio šališkumo priežastis nebuvo konkrečiai aptarta ir išbandyta genomo mastu.

Tos pačios grandinės įdėtųjų genų struktūrų trūkumas galėjo atsirasti dėl mutacinių procesų, lemiančių įdėtas genų struktūras, vidinių grandinių paklaidų. Arba tai gali būti dėl tos pačios grandinės ir priešingos grandinės įdėtų genų diferencinės atrankos. Yra žinoma, kad keli atvejai, kai genai, perkeliami elementai arba endogeniniai retrovirusai yra įterpti į kitų genų intronus, sukelia nenormalų išorinių, įskaitant genus, susiliejimą (Horowitz ir Berg, 1995 Kaer ir kt., 2011 Maksakova ir kt., 2006). Įrodyta, kad genų įtraukimo klaidingas susijungimas priklauso nuo susiliejimo vietų buvimo perkeliamų elementų arba endogeninio viruso sekose (van de Lagemaat ir kt., 2006 Kaer ir kt., 2011). Įdėtų genų sujungimo vietos labiau trukdo įtraukti genus, kai du genai yra transkribuojami iš tos pačios grandinės. Remiantis šia hipoteze, mes nustatėme, kad tos pačios grandinės įdėtieji genai dažniau yra vieno egzono genai (72,53%) nei priešingos grandinės įdėtieji genai (37,41% FET, P < 10 − 16 ). Dėmesys sutelkiamas į įdėtus genus, turinčius daugiau nei vieną egzoną, tos pačios grandinės įdėtieji genai vis tiek turi mažiau intronų nei priešingos grandinės įdėtieji genai (mediana: vienas intronas (tos pačios grandinės įdėtieji genai) palyginti su. du intronai [priešingos grandinės įdėtieji genai] MWU, P = 0,00013). Mūsų stebėjimas atsirado ne dėl to, kad priešingos grandinės įdėtieji genai yra ilgesni už tos pačios grandinės analogus, nes koduojančios sekos ilgis statistiškai nesiskiria tarp tos pačios grandinės ir priešingos grandinės įdėtų genų (mediana: 817,5 [ta pati grandinė], palyginti su 898 [ta pati grandinė]). priešinga kryptis] MWU, P = 0.11).

Septyniasdešimt trys įdėtieji genai yra jauni (mažiau nei 35 mln. metų [Clark ir kt., 2007 Zhang ir kt., 2010]) ir atsirado dubliuojant kitą geną (tėvų geną). Dubliavimosi procesas gali vykti per DNR arba RNR tarpinius produktus. RNR pagrįsto dubliavimosi ypatybė yra ta, kad nauji genai praranda visus intronus, kurie iš pradžių buvo jų tėvų gene (apžvelgta Kaessmann ir kt., 2009), ir šis procesas sudaro apie 12,10 % dubliuojamų genų. Drosophila (Zhang ir kt. 2010). Iš 73 dubliuojamų lizdinių genų tik 16,67% priešingos grandinės dubliuotų genų atsirado dėl RNR dubliavimo, o 42,11% tos pačios grandinės dubliuotų genų atsirado per RNR tarpinius produktus (FET, P = 0,054). Šis skirtumas yra nežymiai reikšmingas, greičiausiai dėl mažo imties dydžio. Be to, dubliuojamų įdėtųjų genų intronų skaičiaus sumažėjimas, palyginti su atitinkamais jų tėvų genais, yra žymiai didesnis tos pačios grandinės dubliuotų genų atveju nei priešingos grandinės dubliuotų genų (mediana: vieno introno skirtumas [tos pačios grandinės įdėtos genai] prieš nulinį intronų skirtumą [priešingos grandinės įdėtieji genai] MWU, P = 0,028). Atkreipkite dėmesį, kad šis skirtumas nėra susijęs su tos pačios grandinės ir priešingos grandinės lizdinių genų tėvų genų intronų skaičiaus kitimu, kuris labai nesiskiria (MWU, P = 0.41).

Jei klaidingas susijungimas iš tiesų yra labiau tikėtinas, kai įtraukiami genai, o įdėtieji genai yra toje pačioje grandinėje, nei tada, kai jie yra priešingose ​​gijose, tikimės, kad ta pati grandinė, įskaitant genus, yra mažiau svarbi musių tinkamumui. Kraštutiniais atvejais tikimės, kad tos pačios grandinės, įskaitant genus, RNR trukdžių (RNRi) funkcijos praradimas arba ekspresijos numušimas yra mažiau susijęs su mirtinais fenotipais. Įvertinus visus tos pačios grandinės ir priešingos grandinės genus, įskaitant genus, nėra reikšmingo skirtumo tarp genų, turinčių žinomus mirtinus fenotipus, proporcijos (38,85 % [ta pati grandinė] ir 44,66 % [priešinga grandinė] 1 lentelė). Tačiau, kai svarstėme tik genų, kurių įdėtuose genuose yra intronų, įtraukimą (todėl labiau tikėtina, kad jie sukelia klaidingą susijungimą), tos pačios grandinės, įskaitant genus, žinomi mirtini fenotipai yra žymiai mažesnė tikimybė (26,0 % [ta pati grandis], palyginti su 42,33 %). priešinga kryptis] 1 lentelė). Rezultatas sustiprėja, jei atsižvelgsime į mirtinus ir sterilius fenotipus (30,00 % [ta pati kryptis] ir 47,44 % [priešinga kryptis] 1 lentelė). Verta paminėti, kad genetinis sutrikimas (nulinis mutantas arba ekspresijos numušimas), kurį mes čia svarstėme, yra ekstremalus, ir tikėtina, kad, įvertinus subtilesnę įtaką kūno rengybai, skirtumas tarp tos pačios grandinės ir priešingos grandinės, įskaitant genus, bus didesnis. reikšmingas ir turėtų būti bendresnis. Apskritai, mūsų pastebėjimai, kad tos pačios grandinės įdėtuose genuose yra mažiau intronų ir kad tos pačios grandinės, įskaitant genus, yra mažesnė tikimybė, kad jie bus susieti su mirtinais ir steriliais fenotipais, rodo, kad tos pačios grandinės lizdinių / įskaitant genų porų trūkumas gali būti siejamas su gryninimu. atranka nuo netinkamo susijungimo, kai įdėtieji genai transkribuojami iš tos pačios grandinės.

1 lentelė

Žinomas fenotipinis genų įtraukimo poveikis

MirtinasSterilusGyvybingasFET P Vertė
Mirtinas prieš nemirtiną a Paveiktas b ir gyvybingas
Viskas, įskaitant genusTa pati kryptis689980.230.2
Priešinga kryptis15919178
Įskaitant genus su intronų turinčiais įdėtais genaisTa pati kryptis132350.0370.027
Priešinga kryptis9111113

a Genai be žinomo mirtino fenotipo (galėjo žinoti sterilų fenotipą).

b Genai, turintys žinomą mirtiną arba sterilų fenotipą.

Įdėtieji genai vystosi greičiau, yra siauriau išreikšti ir yra praturtinti su sėklidėmis susijusiomis funkcijomis, o įtraukiant genus rodo priešingus modelius

Norėdami patikrinti, ar genai įdėtose struktūrose rodo skirtingus evoliucijos modelius, ištyrėme kodavimo variantų dažnių spektrą (naudodami Tajima’s D [Tajima 1989]), santykinis baltymų evoliucijos greitis (dN/dS, [Yang 2007]), ir aminorūgščių pakeitimų dalis, nustatyta teigiamos atrankos būdu (α, [Smith ir Eyre-Walker, 2002]), įtraukiant genus, įdėtus genus ir kontrolinius genus bei klasifikuojamus genus į tuos, kurie yra visuose 12 Drosophila rūšių (t. y. genai, senesni nei 35 mln. metų Clark et al. 2007) ar ne (Zhang et al. 2010) (2 lentelė). Įskaitant genus, yra daugiau neigiamų Tajima’s D, žemesnė dN/dS, ir labiau tikėtina, kad jie bus išsaugoti Drosophila nei įdėtieji genai ar kontroliniai genai, o tai rodo, kad jiems taikoma stipresnė valymo atranka. Kita vertus, įterpti genai, nors ir nesiskiria Tajima’s D iš kontrolinių genų, turi didesnius dN/dS ir α, ir yra linkę būti jaunesni nei abu, įskaitant genus ir kontrolinius genus. Šiose analizėse nenustatėme jokio reikšmingo skirtumo tarp tos pačios ir priešingos grandinės, įskaitant genus ar įdėtus genus.

2 lentelė

Įdėtųjų, įskaitant ir valdymo genų evoliucinės savybės ir išraiškos modeliai

Mediana MWU testas P Vertė
ĮskaitantĮdėtaKontrolėĮskaitant ir NestedĮskaitant prieš kontrolęĮdėtas prieš valdymą
Tajima’s D𢄢.76𢄡.77𢄡.87㰐 𢄨 㰐 𢄨 Ϡ.05
dN/dS0.0420.1070.073㰐 𢄨 㰐 𢄨 <10 𢄨
α0.2510.4350.3430.0050.2750.035
Išraiškos plotis (audinių skaičius)18419<10 � 0.363<10 �
Proporcija (%) FET P vertė
ĮskaitantĮdėtaKontrolėĮskaitant ir NestedĮskaitant prieš kontrolęKontrolė prieš įdėtą
Išsaugotas per 12 Drosophila rūšių99.0588.1391.24㰐 � 㰐 � 0.027
Aukščiausia išraiška smegenyse29.095.219.44<10 � <10 � 0.003
Aukščiausia sėklidžių išraiška6.4343.9113.52<10 � 1.45 × 10 𢄦 <10 �
Aukščiausia ekspresija kiaušidėse13.785.3623.941.3 × 10 𢄧 9.06 × 10 𢄨 <10 �
Jauni pasikartojantys genai0.98.47㰐 � 5.2 × 10 � 0.02

Taip pat nustatėme, kad įdėtieji ir įskaitant genus turi neįprastus genų ekspresijos modelius. Įdėtieji genai ekspresuojami žymiai mažiau audinių (turi siauresnį raiškos plotį), nei įtraukiant genus arba kontrolinius genus (2 lentelė). Jie taip pat turi žymiai didesnį ekspresijos specifiškumą (žr. Medžiagos ir metodai), nei įtraukiant arba kontroliuojančius genus (MWU, P < 10 � abiem palyginimams pav. 2). Nors tos pačios ir priešingos grandinės įdėtieji genai savo išraiškos pločiu nesiskiria (MWU, P = 0,15), tos pačios grandinės įdėtieji genai turi žymiai didesnį ekspresijos specifiškumą nei priešingos grandinės įdėtieji genai (0,95 [ta pati grandinė] prieš. 0,93 [priešinga kryptis] MWU, P = 0,009). Audinių, kuriuose genų ekspresija yra didžiausia, sudėtis taip pat labai skiriasi, įskaitant genus, įdėtus genus ir kontrolinius genus (chi kvadrato testas, P < 10 − 16 visiems palyginimams pav. 3). Ši sudėtis nesiskiria tarp tos pačios ir priešingos grandinės, įskaitant genus, bet labai skiriasi tarp tos pačios ir priešingos grandinės įdėtų genų (chi kvadrato testas, P = 0,024 pav. 3). Įskaitant genus, jie yra labiau praturtinti genais, kurių ekspresija smegenyse yra didžiausia, nei įdėtieji genai arba kontroliniai genai (2 lentelė). Priešingai, įdėtieji genai yra žymiai praturtinti genais, kurių ekspresija sėklidėse yra didžiausia, tačiau jų trūksta genų, kurių ekspresija didžiausia kiaušidėse (2 lentelė). Didelės sėklidžių ekspresijos praturtėjimas ypač stiprus tos pačios grandinės įdėtiesiems genams (58,46 % [ta pati grandinė], palyginti su. 38,18 % [priešinga kryptis] FET, P = 1.67 × 10 − 6 ).

Genų ekspresijos specifiškumas įdėtose struktūrose ir kontroliniuose genuose. Boxplots, skirtas ekspresijos specifiškumui, įtraukiant genus, įdėtus genus ir kontrolinius genus. Ekspresijos specifiškumas yra didžiausias tos pačios grandinės įdėtiesiems genams, po kurių seka priešingos grandinės įdėtieji genai, kurie abu yra žymiai didesni nei įskaitant genus arba kontrolinius genus.

Audinių, kuriuose genų ekspresija yra didžiausia, pasiskirstymas. Įdėtieji genai, ypač tos pačios grandinės įdėtieji genai, yra praturtinti genais, kurių ekspresijos lygis sėklidėse yra didžiausias, lyginant su įtraukiančiais ir su kontroliniais genais. Priešingai, įskaitant genus, jie yra praturtinti genais, kurių didžiausia ekspresija smegenyse.

Remiantis ankstesne išvada, kad dauguma įdėtųjų genų struktūrų atsirado įterpus DNR sekas į intronus, įtraukiant genus per genų dubliavimą (Assis ir kt., 2008), mes pastebėjome žymiai didesnę dalį įdėtųjų genų, kurie anksčiau buvo identifikuoti kaip jauni dubliuoti genai ( Zhang ir kt., 2010), nei įtraukiant genus arba kontrolinius genus (2 lentelė). Jauni pasikartojantys genai linkę greitai vystytis (Chen ir kt., 2010), o tai galėjo lemti pastebėtas išskirtines įdėtųjų genų evoliucines savybes. Kita vertus, plačiai žinoma, kad dvi įdomios įdėtųjų genų savybės – siaura ekspresija (Larracuente ir kt., 2008) ir aukščiausios ekspresijos sodrinimas sėklidėse (apžvelgta Swanson ir Vacquier 2002) — yra plačiai žinomos kaip susijusios su greita baltymų evoliucija. Norėdami patikrinti, ar neįprastos įdėtųjų genų evoliucinės ir ekspresijos savybės atsiranda dėl didesnės pasikartojančių genų dalies, palyginome įdėtus genus su kontrolinių genų rinkiniu, turinčiu tokią pačią jaunų pasikartojančių genų dalį (𠇍uplikacijos kontrolės genai,&#). x0201d žr. Medžiagos ir metodai). Įdėtieji genai vis dar rodo greitesnį baltymų evoliucijos greitį (dN/dS, MWU, P < 10 − 9), turi didesnį α (MWU, P = 0,0021], yra išreikšti mažiau audinių (MWU, P < 10 − 16 ), turi didesnį išraiškos specifiškumą (MWU, P < 10 − 16 ), ir yra praturtinti genais, kurių didžiausia ekspresija sėklidėse (FET, P < 10 − 16 ). Šie rezultatai rodo, kad pastebėtų modelių negalima paprasčiausiai paaiškinti didesne pasikartojančių genų dalimi. Priešingai, naudojant kitą kontrolinių genų rinkinį, turintį tokius pačius ekspresijos modelius kaip ir įdėtieji genai (�kspresijos kontrolės genai,” žr. Medžiagos ir metodai), įdėtieji genai reikšmingai nesiskiria nuo kontrolinių genų. dN/dS, α, arba genų amžius (MWU, P > 0,05 visiems palyginimams). Atitinkamai, įdėtų genų evoliucinės savybės galėjo būti jų išraiškos atributų 𠇋y-product”. Tačiau atranka, siekiant atsieti įdėtųjų genų funkcijas nuo genų įtraukimo dėl jų įdėtų struktūrų, galėjo lemti pastebėtą siaurą įdėtųjų genų ekspresiją ir gali būti pagrindinė įdėtųjų genų evoliucinių savybių priežastis.

Nors įtraukiami genai lėtai vystosi, labai konservuoti, plačiai išreikšti ir praturtinti genais, kurių didžiausia ekspresija smegenyse, įdėtieji genai yra priešingi: greitai besivystantys, siaurai išreikšti ir praturtinti genais, kurių didžiausia ekspresija sėklidėse. Taigi, teigiama genų ekspresijos ir biologinės funkcijos koreguliavimo atranka, kuri galėjo paskatinti genų grupių evoliuciją (apžvelgta Hurst ir kt., 2004), mažai tikėtina, kad bus taikoma fiksuojant įdėtas genų struktūras. Įdėtų genų struktūrų fiksavimas, kaip ir kitų sudėtingų genominių organizacijų evoliucija (Lynch ir Conery 2003 Lynch 2006), galėjo būti beveik neutralus procesas. However, we have evidence supporting the role of natural selection in shaping the relative orientations and functional importance of nested gene structures. We showed that nested/including gene pairs are less likely to be transcribed from the same strand and that same-strand nested genes are more likely to be single-exon genes and have fewer exons if they are multiexon genes. Together with the finding that including genes with same-strand nested genes that contain introns are less likely to be essential for fitness of flies, our results support that selection against missplicing events of same-strand nested/including gene pairs leads to this bias. In addition, the correlations in expressions and biological functions of nested/including gene pairs are lower than those of nearby gene pairs but similar to any two random genes of the same chromosome. This is consistent with the hypothesis that selection against transcriptional interference plays an important role in shaping the functional significance and indirectly affects evolutionary properties of nested gene structures. In sum, despite the proximity of nested and including genes, we found that they are nowhere similar to each other in terms of evolutionary properties, expressional patterns, and biological functions, and selection against the potential deleterious impacts caused by their close proximity might have been the main force governing their evolution.


Fonas

Polyunsaturated fatty acids (PUFAs) are essential components of the plasma membrane. Various PUFAs have crucial roles in plant physiological and cellular processes such as cold acclimation, defense mechanisms against biotic and abiotic stresses, and chloroplast development [1]. PUFAs biosynthesis occurs through different and complex pathways of desaturation and elongation steps [2]. Fatty acid desaturase (FAD) enzymes introduce double band into fatty acids hydrocarbon chain. Two groups of FAD have been identified in plants, including acyl–acyl carrier protein (acyl-ACP) desaturases and membrane-bound FADs or acyl-lipid desaturases [3]. While identified FADs in plants, animals, algae, and fungi are membrane-bound desaturase, the plant acyl-ACP desaturase (FAB2/SAD) is the only soluble FAD [4, 5]. The acyl-ACP desaturases introduce the first double band into the acyl chain of saturated fatty acid in plastids. Besides, Membrane-bound FADs exist in chloroplast and endoplasmic reticulum (ER). Desaturation processes occur through two different pathways in the chloroplast and the ER [6]. In the chloroplast and ER, double bond formation requires NADPH/ferredoxin and NADH/cytochrome b5 systems as the electron donors, respectively [7].

On the other hand, the quality of edible oils depends on the unsaturated fatty acids content [8]. FADs are essential to determine the quality of edible oils [9]. They have been attracted more attention due to their ability to adjust the level of unsaturated fatty acids to increase the quality of these oils and plant resistance against various stresses including drought, salt, heat, cold, and pathogen [10,11,12,13]. For instance, the cell membrane is the primary site for cold-induced injury, and the melting temperature of the unsaturated fatty acids is less than saturated fatty acids. Therefore, adjustment of membrane lipid fluidity through manipulation of FADs and changing the levels of unsaturated fatty acids might seem helpful for cold acclimation [14]. To date, several studies have been conducted to assess the expression of genes encoding fatty acid desaturase in response to biotic and abiotic stresses [12, 15,16,17]. Investigation of the expression of SACPD-A ir SACPD-B genes (encoding soluble Δ9 stearoyl-ACP desaturases) and the amount of stearic acid (C18:0) and oleic acid (C18:1) in soybean revealed that the number of transcripts of both genes and oleic acid had been dramatically increased in low temperature. Reversely, we observed an increased amount of C18:0 and decreased the expression of the genes above at high temperatures [18]. Wang ir kt. (2012) ascertained the expression of oleate desaturase (GbFAD2 ir GbFAD6) and GbSAD genes under various temperatures in Ginkgo biloba L. leaves. Based on their results, the expression of GbFAD2 ir GbSAD genes has been increased in 4 and 15 °C, while it has been prevented in 35 and 45 °C.

In contrast, the expression of GbFAD6 was constant at different temperatures [19]. The expression of FAD2–1 ir FAD2–2 genes of olive has been increased in response to wounding [20]. Taip pat, FAD2 ir FAD6 genes are necessary for salt tolerance during early seedling in Arabidopsis [21, 22]. Zhang ir kt. (2005) developed transgenic tobacco plants with the overexpressing FAD3 arba FAD8 genai. According to their findings, the over-expression of FAD8 arba FAD3 genes caused enhanced tolerance to drought [23]. The importance of FADs in plant pathways has been confirmed previously. A homologous region based on a conserved sequence of a gene family can be applied to identify new genes. The FAD gene family is vital for the production of PUFAs in plants thus, a comprehensive understanding of FAD genes using bioinformatics studies can help disclose their functions in the studied plants.

Wheat (Triticum aestivum L.) is one of the most important cereal crops. Because of the high amount of unsaturated fatty acids, wheat germ oil, one of the essential by-products of wheat, can be a good alternative for edible oils with clinical benefits. Based on studies, wheat germ oil contain different fatty acids, including linoleic acid (C 18:2), palmitic acid (C 16:0), oleic acid (C 18:1), linolenic acid (C18:3), and stearic acid (C 18:0) [24]. Wheat is a good source of edible oil, and the characterization and analysis of the FAD family in wheat plants have not yet been performed. On the other hand, comprehensive analyses on gene families help to address a better understanding of their evolutions and functions in plants [25]. Therefore, in this study, identification, evolutionary relationship, duplication and selection pressure, exon-intron structure, promoter analysis, transcript-targeted miRNA and simple sequence repeat markers prediction, RNA-seq data analysis, three-dimensional structure, and docking studies of the TaFADs have been investigated in wheat using bioinformatics tools. Figure 1 provides a flow-chart of the data analysis process.

A flow-chart of the data analysis process


Medžiagos ir metodai

Genome Sequences

We retrieved all publicly available prokaryotic genome sequences and associated annotations from the Integrated Microbial Genomes (IMG) system (http://genome.jgi-psf.org/programs/bacteria-archaea/index.jsf) ( Markowitz et al. 2009).

Horizontally Transferred Genes

We used three large data sets of HGTs. The first data set ( Sorek et al. 2007) included genes that can and cannot be transformed into E. coli in laboratory. The second data set ( Lercher and Pal 2008) described genes that were naturally transferred into E. coli at different evolutionary times, inferred from the presence/absence of genes across species. The inference was based on the DELTRAN algorithm, with relative penalties of 2:1 for HGTs and gene losses ( Lercher and Pal 2008), as in a recent study ( Gophna and Ofran 2011). We identified the likely donor species of each horizontally transferred gene in this data set by Blasting the gene with an E value cutoff of 10 −6 in all 1,127 finished Bacteria and Archaea genomes in IMG that are outside the family Enterobakterijos, to which E. coli belongs ( fig. 2A). The genome harboring the best basic local alignment search tool (Blast) hit is considered the donor of the transferred gene. Reciprocal Blast searches are unnecessary, because the best Blast hit of the identified donor gene in E. coli will be 1) either the original gene under investigation or 2) a paralog of the original gene under investigation. But, because the gene under investigation was identified by phylogenetic analysis to be horizontally transferred to E. coli rather than a recent paralog of another gene in E. coli, (2) is not possible. Thus, the only possibility is (1), which makes it unnecessary to Blast the E. coli genome using the identified donor gene as the query. Furthermore, errors in donor identification are expected to be random, which would weaken the true signal but not bias our result. The third data set included relatively recent HGTs identified from 171 recipient genomes by nucleotide composition-based Bayesian inference ( Nakamura et al. 2004). We discarded 38 of these genomes because of the lack of any annotation of ribosomal protein genes that are required for determining the preferred codons for codon adaptation index (CAI) estimation.

Genome-Wide Gene Expression Data

We used published E. coli gene expression data from the log growth phase obtained from a high-density oligonucleotide tiling array experiment ( Cho et al. 2009). To download all publicly available microarray expression data from other prokaryotes, we used the Stanford Microarray Database ( Hubble et al. 2009) that houses hundreds of expression data sets based on cDNA microarrays. Expression data from six species (Bacillus subtilis, ID: 66211 Campylobacter jejuni, ID: 28770 Helicobacter pylori, ID: 16576 Mycobacterium tuberculosis, ID: 14047 Salmonella typhimurium, ID: 23956 and Vibrio cholerae: ID 66211) were used in our analysis. We also used the NCBI Gene Expression Omnibus and downloaded the microarray data of Dehalococcoides ethenogenes (GSE 10185), Geobacter sulfurreducens (GSE 22511), Listeria monocytogenes (GSE 16336), and Streptococcus agalactiae (GSE 21564).

Synonymous Codon Usage Bias

To calculate the relative synonymous codon usage (RSCU) in a species ( Sharp and Li 1986), we used ribosomal protein genes, which are generally among the most highly expressed genes in a genome ( Sharp et al. 1986). Based on the RSCU values, the CAI was calculated for each gene in a genome ( Sharp and Li 1987). Briefly, CAI of a gene is the geometric mean of RSCU of all codons divided by the highest possible geometric mean of RSCU given the same amino acid sequence.

Classification of Informational Genes and Operational Genes

Following an earlier study ( Jain et al. 1999), we regarded genes annotated with “transcription,” “translation,” “DNA replication,” or any of their subterms in Gene Ontology ( Ashburner et al. 2000) as informational genes. All other genes were considered operational genes.

Protein–Protein Interactions

The E. coli protein–protein interaction data were retrieved from a recent publication ( Hu et al. 2009), in which 5,993 nonredundant pairwise physical interactions among 1,757 proteins were identified by an affinity-based method and genomic context-based inferences.

Statistinė analizė

We estimated the relative contributions of all predictors to the total variance in gene transferability by calculating the relative contribution of variability explained (RCVE) for each predictor using RCVE = 1 − R reduced 2 / R full 2 ⁠ , where R full 2 and R reduced 2 are the R 2 (square of the correlation coefficient) for the full linear model and the model without the predictor of interest, respectively ( Park and Makova 2009). To diagnose multicollinearity of each predictor, variance inflation factors (VIFs) ( Kutner et al. 2005) were calculated. All predictors in the model used had VIFs below 2, suggesting that multicollinearity did not adversely affect our model. Linear multiple regression analysis was performed in the R statistical package.


Medžiagos ir metodai

Transcriptome and assemblies

We used the embryonic samples of Idiosepius ir Nautilus as well as their adult tissues to capture regulatory genes critical for systemic development of the eye and lens across species. For embryonic eye transcriptomics (RNA-seq) analysis, we utilized assemblies (stage 25 embryos of the pygmy squid, Idiosepius paradoxus and 3-month-old embryos of the chambered nautilus, Nautilus pompilius ) obtained by Ogura et al. (2013) . For adult Idiosepius ir Nautilus , we generated novel sets of RNA-seq data. Tissues of Idiosepius ir Nautilus were removed and homogenized in TRIzol reagent (Invitrogen) immediately after the animals were sacrificed. To minimize possible nucleotide polymorphism, we utilized a single individual of Nautilus . However, due to small sizes of Idiosepius , we pooled tissues from several individuals. Total RNAs were isolated according to the manufacture’s protocol, followed by on column DNase treatment using a QIAGEN RNeasy kit. Qualities of the RNAs were tested by Agilent Nanodrop and Agilent 2100 bioanalyzer. The RNA samples were sent to the BGI Inc and short read sequences were obtained by Illumina Hiseq2000 according to the company’s procedures.

FASTQ sequences of Idiosepius arba Nautilus were pooled into one dataset and were assembled using the Trinity platform ( Grabherr et al. 2011 ). To obtain normalized intensities of gene expression across tissues (fragments per kilobase per million reads, FPKM), reads from each sample was mapped onto the Trinity assembly with Bowtie ( Langmead et al. 2009 ) and analyzed with RSEM ( Li and Dewey 2011 ) and edgeR ( Robinson et al. 2010 ). In the assembly procedure, variants of putative alternative splicing (sub-components of the Trinity output) were estimated as different contigs, but we merged variants from one sub-component based on the “%comp_fpkm” values of edgeR output. Analytical pipelines on a NIG Cell Innovation program ( http://cell-innovation.nig.ac.jp/ ) were used with the annotation steps to the assembled contigs.

Data from the eyes of Idiosepius were assembled together with data from brain, arm, gonad, and gut. Contigs shorter than 500 bp and FPKM less than 1 were filtered out. Contigs that passed the criteria are used as “the eye genes”. Data from Nautilus eyes were assembled together with data from brain, arm, and siphuncule and processed in the same way. Sequence homology was tested using NCBI BLAST 2.2.30+ ( Camacho et al. 2008 ) after filtering out genes shorter than 500 bp to remove gene fragments having traceability. For comparative analysis, we obtained gene models from two gastropods, the sea hare Aplysia californica (AplCal3.0, GCF_000002075.1, July 2013) and the giant owl limpet Lottia gigantea (Lotgi1, INSDC Assembly GCA_000327385.1, January 2013) the Pacific oyster, Crassostrea gigas (oyster_v9, INSDC Assembly GCA_000297895.1, September 2012) the polychaete annelid, Capitella telata (Capitella teleta v1.0, INSDC Assembly GCA_000328365.1, December 2012) the fly, Drosophila melanogaster (BDGP6, INSDC Assembly GCA_000001215.4) and human (GRCh38, INSDC Assembly GCA_000001405.15, December 2013) from Ensembl. Eye transcriptome data from human fetuses were obtained from an EST analysis by Choy et al. (2006) . Choy et al. (2006) listed 4010 human gene models as the fetal eye genes using the previous human genome build. However, 669 genes were missing in the current human genome build (the Ensembl Human Build 38). To compensate, we obtained EST sequences from NCBI (BY794942-BY800475) and used these sequences in the search for homology.

Molecular phylogenetic analysis

The nucleotide sequences obtained in this study are available under the following accession numbers: [DDBJ: LC021432-LC021456] and listed in Supplementary Table S2 . For each set of genes (opsins, arrestins, and crystallins), we obtained 97, 16, and 31 sequences from the NCBI and made alignments together with 7, 3, and 14 cephalopod sequences found in this study, respectively. The NCBI accession numbers of the genes are shown in the respective figures.

We used MUSCLE on the EMBL-EBI Web Services to generate a multiple sequence alignment ( Edgar 2004 McWilliam et al. 2013 ). To remove poorly aligned sequences we used TrimAl v1.4.rev15 build[2013-12-17] with -gappyout option ( Capella-Gutierrez et al. 2009 ). Maximum-likelihood inference of phylogenetic trees was inferred using RAxML version 8.0.26 (-f a -No. 1000 -m PROTGAMMAGTR options were applied) ( Stamatakis 2014 ). One thousand bootstrap replicates were performed with the same search options as described above.

In situ hibridizacija

To generate Idiosepius Tbx20 DIG-labeled RNA targeted probes, we performed RT-PCR using the following primer set (F: ACCAGCCTCGAATTCACATC, R: GGAGGCCCAAATTAGGAAAG). To generate the Idiosepius cDNA, we utilized SMARTer RACE kit (Takara Clontech). The PCR fragments obtained from the RT-PCR were sub-cloned into T-vector (Promega) and used as templates for in vitro transcription using DIG RNA probe synthesis kit (Roche). Whole-mount savo vietoje hybridization was performed using stage 25 embryos of Idiosepius according to the previously published protocol ( Yoshida et al. 2010 ).


Diskusija

Linking Gene Expression and Phenotypic Traits

To advance our understanding of how molecular mechanisms allow organisms to adapt to and persist in altered environments, we linked gene coexpression networks with changes in phenotypic traits using resurrected Dafnija isolates separated by centuries of evolution and anthropogenic change. Network analyses allowed us to identify gene clusters and their networks that may underlie organismal responses to environmental shifts. To provide a direct phenotype–genotype link, we applied such a network approach and combined it with quantitative trait data observed in members of a single Dafnija population before and after a historic shift in nutrient supply associated with modern agricultural activities ( Frisch et al. 2014 Roy Chowdhury et al. 2015). Specifically, we explored the transcriptional regulation of two physiological traits related to P acquisition (RE and bP), and a higher order phenotypic trait dependent on RE and bP, that is, somatic GR, using a trait-associated gene coexpression network. The resulting network suggests a strong relationship of transcriptional responses with P-supply, with over 50% of the 17 observed modules significantly associated with the P-related phenotypic traits.

Our analysis identified distinct genes and pathways that were tied to individual phenotypic traits, and that are potential candidates for further exploration of their role in evolutionary adaptation to P enrichment.

Retention Efficiency

Two hubgenes of brown_RE belonged to the jumonji gene family that is known to regulate chromatin organization and thus gene expression ( Takeuchi et al. 2006). This finding suggests a certain degree of epigenetic regulation (previously described as DNA compaction in Dafnija Jalal et al. 2014) in RE. Overrepresentation of genes in purple_RE involved in amino acid metabolism (including trypsins) may indicate the exploitation of alternate P-sources under P-limitation as seen in plants ( Abel et al. 2002). One of the three top hubgenes was a MCO, a gene family essential for iron metabolism in many organisms ( Lang et al. 2012). Previous research in Dafnija identified a significant interaction between P-limitation and iron-kinetics ( Lind and Jeyasingh 2018). This finding, together with our results suggests a central role of MCOs in modulating essential cellular processes under P-limitation.

Body P

Regulation of body P might be necessary in order to counteract the effect of unusually high RE in ancient clones, and to retain cellular homeostasis, for example, by active release of inorganic P ( Rigler 1961) or moulting ( He and Wang 2007).

We speculate that the tan_bP genes highly expressed under HiP in ancient clones including many nonannotated genes (supplementary fig. S5c, Supplementary Material online) may contribute to the maintenance of defined bP concentrations when P is abundant. Regulation of bP may additionally be achieved by one of the hubenes of greenyellow_bP identified as a histone tail meythylase. Histone tail methylation has profound effects on gene transcription and can be passed transgenerationally in invertebrates, with the possibility of a long-lasting epigenetic memory of environmental conditions ( Klosin et al. 2017). Correlation of bP with genes involved in protein metabolism suggest that both ancient and modern genotypes are able to maintain homeostasis in body P-content in response to dietary P-supply by producing metabolic adjustments in P-usage.

Growth Rate

In contrast to the trait–module correlations of RE and bP, which were driven by evolutionary history (contrasting ancient or modern clones), GR module correlations were driven by treatment, with similar responses of ancient and modern clones, suggesting environmentally induced gene expression. The observed functional enrichment in signaling cascades involving transmitters and receptors indicates such environmental triggering of gene expression, particularly in blue_GR. According to the Growth Rate Hypothesis ( Main et al. 1997 Sterner and Elser 2002), GR is a trait that strongly depends on various molecular and physiological parameters controlling P-allocation to ribosomal RNA. Thus, when P supply in the environment is not limiting, these signaling cascades may lead to an increased rRNA biogenesis, thus increasing GR ( Sterner and Elser 2002). Coregulation of these genes by several transcription factors lends further support to this idea: genes controlled by the top three promoter motifs in each of the two modules reflect the same functional enrichment as the entire module ( fig. 3c). Notably, a large number of blue_GR genes are potentially coregulated by two or more promoter binding sites ( fig. 3c). Phosphoglycerate dehydrogenase, one of the lightgreen_GR hubgenes is crucial to L-serine biosynthesis, an amino acid central to cellular proliferation ( de Koning et al. 2003). Vienas iš blue_GR hubgenes, carbonic anhydrase, is a zinc metalloenzyme involved in several biological processes such as the transport of CO2, maintaining acid-base balance, glycogen, and lipid synthesis ( Zolfaghari et al. 2014). Both enzymes therefore mediate multiple pathways that can play a significant role in regulating growth. Enriched gene families of blue_GR genes included signal transduction mechanisms, involving phosphodiesterases and phosphatases. These are known to be involved in P-scavenging in plants ( Plaxton and Tran 2011), but also in Dafnija (e.g., alkaline phosphatase McCarthy et al. 2010).

Evolution of Gene Expression Patterns and Networks

Adaptation to environmental change is typically associated with divergent gene expression patterns ( DeBiasse and Kelly 2016 Kenkel and Matz 2016 Sikkink et al. 2019). The trait-associated, transcriptional responses of ancient and modern Dafnija observed here support such findings ( fig. 2b), providing evidence of distinct evolved patterns of gene expression: constitutive gene expression (brown_RE), conserved gene expression plasticity (lightgreen_GR, blue_GR), and evolved plasticity (purple_RE, greenyellow_bP), sensu Renn and Schumer (2013). Given that the interaction of genes within modules is stronger than between modules, and that modules are regarded as “semi-independent” units that evolve independently due to reduced pleiotropic constraints ( Wagner et al. 2007 Snell‐Rood et al. 2010 Lotterhos et al. 2018), the coexistence of these observed gene expression patterns within a single network strongly supports the idea of individual evolutionary trajectories of these trait-associated modules.

Plastic gene expression in response to P-supply was common to almost all focal modules, but was not limited to ancient or modern clones ( fig. 2 and table 1). For example, RE correlated strongly with modules that showed signs of newly evolved plasticity (i.e., purple_RE). In contrast, genes in both GR-associated modules (i.e., blue_GR, lightgreen_GR) maintained similar gene expression plasticity in ancient and modern clones. While our data suggest that gene expression is often plastic, such plasticity did not always translate into similar plasticity in the tested phenotypic traits (e.g., GR): a plastic gene expression in ancient clones was less obvious in their phenotypic response. A potential explanation for this may be the complexity of this trait that depends on many other factors, including nutrient availability and assimilation, and other factors involved in cellular and developmental processes.

Complementing the trait-associated network, the use of network preservation statistics can identify the “wiring” of molecular mechanisms that are shared or divergent between ancient isolates and their modern counterparts ( Oldham et al. 2006). Our results highlight a highly preserved network structure with >70% of the ancient Dafnija modules preserved in modern descendants that was also reflected by shared gene regulatory mechanisms in ancient and modern modules (i.e., bluePres). Such a pattern is not unexpected in members of the same population, considering a similar level of preservation in closely related taxa that diverged from a common ancestor several million years ago (such as humans and chimpanzees Oldham et al. 2006). However, the analysis of network preservation also revealed patterns of evolutionary divergence of ancient Dafnija and their modern descendants in individual modules. In this context, the detection of a newly formed module (geltonaPres) in the modern Dafnija genotypes was especially striking. Such new modules provide evidence for evolutionary novelty on the level of transcription ( Oldham et al. 2006). Analysis of the gene expression pattern of geltonaPres revealed a plastic response of module members to P-availability, highlighting the role of gene expression plasticity in the evolutionary adaptation to P-supply. However, we found that in order to obtain detailed information about the evolutionary history of such plasticity, the consideration of network preservation statistics and resulting modules in isolation is insufficient. By integrating preservation and trait-associated networks, we were able to establish a link between the evolution of gene expression and phenotypic plasticity. Here, the presence of a high percentage of the geltonaPres genes in two trait-associated modules, purple_RE (“evolved plasticity”) and blue_GR (“conserved plasticity”) indicated the coexistence of different types of plasticity in a single module (here: geltonaPres), and that this plasticity may be associated with different traits.

Concluding Remarks

To genuinely advance the understanding of phenotypic evolution, comprehensive methods are required that consider entire organisms instead of single traits ( Forsman 2015). Such a holistic understanding is vital in order to predict evolutionary trajectories that result from major geochemical shifts that currently affect our planet, and is essential for the development of conservation strategies. The results presented here are a contribution toward such an understanding, and emphasize the need for an integrative approach that combines physiological and “omics data” in keystone species.

Genomic manifestation: theory predicts relaxed selection on loci underlying genetically controlled phenotypic plasticity and thus higher genomic variation in associated genes (Snell‐Rood et al. 2010). This raises the question whether the observed differences in gene expression between ancient and modern Dafnija clones are manifested in the genomic sequence, for instance as increased genetic divergence in modules with evolved plasticity.

Molecular regulators of phenotypic plasticity: while transcriptional regulation provides a critical mechanism for organisms to respond rapidly and efficiently to environmental change ( Turner 2009), the contribution of different molecular regulators of plasticity (e.g., epigenetic modifications, transcription factors) remain largely unknown and should be considered in future research.

Role of hubgenes: on a functional level, recent advantages in molecular techniques now allow for a detailed analysis of network structures to test if molecular cascades collapse when predicted hub-genes are modified via gene editing approaches (e.g., RNAi or CRISPr and Talen techniques Nakanishi et al. 2014 Naitou et al. 2015 Rivetti et al. 2018).

Contrasting resurrected members of populations that lived hundreds of years ago with their modern descendants, as done here, is a rare opportunity to track evolutionary trajectories in natural environments. Our study highlights the prospects of resurrection ecology when integrated with modern biology. It further emphasizes the applicability of this approach to numerous other organisms that produce dormant stages with long-term viability, and its significance for an in-depth understanding of evolutionary adaptation to global environmental change.


Results and Discussion

Old-Biased Genes Are Not under Weaker Selection

Evolutionary theories of ageing predict weaker selection on genes which are expressed in old individuals due to low effective population size and reduced fecundity ( Kirkwood and Austad 2000 Flatt and Partridge 2018). In ant queens, we may expect a reduction of this “selection shadow” as low extrinsic mortality and lifelong, high fertility should lead to a stable effective population size up to old age. We tested this by estimating and comparing selection strength between three groups of genes. These were 1) old-biased genes n = 46: significantly over-expressed in seven old (18 weeks) compared with seven young (4 weeks) C. obscurior queens 2) young-biased genes (n = 96): significantly over-expressed in young compared with old queens 3) unbiased genes (n = 2,616): no significant difference in expression between young and old queens. To estimate direction and strength of selection, we measured dN/dS (ratio of nonsynonymous to synonymous substitution rates) for one-to-one orthologs with a set of 10 ant species (see Materials and Methods). A dN/dS ratio ≈ 1 indicates neutral evolution, whereas values ≪ 1 signify purifying selection. We find no evidence for weaker purifying selection in old-aged queens, since dN/dS in old-biased genes (median: 0.084) is in fact significantly lower than in young-biased genes (median: 0.127 P value = 0.016 Mann–Whitney U test fig. 1), indicating increased purifying selection with age. This is in contrast to published results for age-biased genes in humans, in which old-biased genes had a significantly higher dN/dS (median: 0.22) than young-biased genes (median: 0.09, P = 1.4 × 10 – 50 ), as would be expected for a reduction in purifying selection with age ( Jia et al. 2018). This was confirmed by a further study on several mammalian tissues, in which an adjusted dN/dS metric correlated more strongly with expression in young compared with old individuals ( Turan et al. 2019). Interestingly, dN/dS in young-biased genes is also significantly higher than in unbiased genes (median: 0.100 P value = 2.2 × 10 −4 Mann–Whitney U test), as has previously been reported for the ant, Lasius niger ( Lucas et al. 2017). To further test the ability of this method to detect a selection shadow in insects, we repeated the analysis for D. melanogaster. Age-biased gene expression was measured for a novel data set containing expression data for young (10 days) and old (38 days) female flies across two tissues (head and fat body) and different feeding regimes. Evolutionary rates were obtained for these genes from published analyses based on alignments of 12 Drosophila species ( Clark et al. 2007). In contrast to our results for ant queens but in agreement with expectations for a selection shadow, we find significantly higher dN/dS levels in old-biased fly genes (median: 0.060) compared with young-biased genes (median: 0.047 P = 5.1 × 10 −8 Mann–Whitney U test).

Evolutionary rates (dN/dS) in genes with unbiased expression, young-biased, and old-biased expression in C. obscurior queens and D. melanogaster adult females. Significance was tested with Mann–Whitney U bandymas.