Informacija

Kaip galime sukurti gyvą dinozaurą naudodami DNR technologiją?

Kaip galime sukurti gyvą dinozaurą naudodami DNR technologiją?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Man įdomu, ką turėtume daryti, kad sukurtume gyvą dinozaurus naudojant DNR technologiją? Jei tai neįmanoma naudojant dabartines technologijas, ar tai kada nors bus įmanoma?

Filme „Juros periodo parkas“ mokslininkai išskiria dinozauro DNR iš uodo, kuris buvo išsaugotas gintare ir kuris išsiurbė kraują iš dinozauro. DNR yra neišsami, todėl mokslininkai sujungia ją su varlės DNR. Tada DNR įterpiama į krokodilo kiaušialąstę ir sukuriamas embrionas ir t.t.

Jurrassic parko metodas yra abejotinas. Nors dinozaurų DNR buvo rasta ir išskirta, ji buvo per daug pažeista, kad pagal dabartinę technologiją būtų atkurta pradinė forma. Neaišku, ar sujungimas su varlės DNR veiktų. Šiuo metu pamirškime apie tai, kaip dinozauro embrionas vystytųsi, o kiaušinėliai inkubuotųsi ir išsiritų. Noriu sužinoti, kaip galėtume visiškai suskirstyti kokio nors dinozauro genomą?


Plačiai pripažįstama, kad paukščiai yra iš tikrųjų dinozaurai. Kladistiškai kalbant, norint sukurti gyvą dinozaurus, nereikia jokios DNR technologijos, nes jie jau egzistuoja.

Darant prielaidą, kad norite padaryti tą patį su a ne paukščių dinozauras (parafiletinė grupė), tačiau geriau būtų paklausti World Building SE, nes mokslinių tyrimų šia tema buvo mažai arba visai nebuvo, o spekuliatyvūs atsakymai čia paprastai laikomi ne į temą.


Palyginti su susijusia DNR, kaip tai buvo daroma praeityje su vilnoniu mamutu. Taigi gali reikėti pakankamai išgauti ir surasti pakankamai artimų giminaičių, kad tai padarytų. Tačiau iš to, ką perskaičiau, DNR yra taip stipriai suskaidyta, kad santykinai neįmanoma susieti net su artimais giminaičiais. Tai galite suprasti taip, kad kuo labiau suskaidyta DNR, tuo mažesnės jos dalys. Taigi, jei turite tokią sruogą:

ACTGATCGTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTACTACTAGCT

Jis yra ilgas ir gali susieti tik vieną ar dvi giminaičio genomo vietas. Bet jei turite labai suskaidytas sruogas, kurios yra daug trumpesnės, pavyzdžiui:

AGTC

Galite įsivaizduoti, kad tai atitiktų milijonus skirtingų vietų. Taigi jų sutvarkyti iš esmės būtų neįmanoma.

Taip pat turime įtraukti šiuos dalykus į laiko juostą, kad iš tikrųjų suprastume sunkumus, vilnonieji mamutai gyveno prieš 500 000 metų, o dinozaurai buvo prieš 60 milijonų metų.


Kaip pasidaryti dinozaurą

1 ŽINGSNIS)Raskite gintaro gabalėlį, kuriame įstrigęs kraują siurbiantis vabzdys iš dinozaurų eros.

2 ŽINGSNIS)Ištraukite kraują, kurį vabzdys išsiurbė iš dinozauro.

3 ŽINGSNIS)Naudokite kraujyje randamą dinozauro genetinį kodą (DNR) kaip kito dinozauro brėžinius. Jei trūksta DNR dalių, užpildykite tarpus varlės DNR.

4 ŽINGSNIS)Naudokite šiuos mėlynus atspaudus, kad sukurtumėte dinozauro kiaušinį.

5 ŽINGSNIS)Perinti dinozaurą inkubatoriuje.

6 ŽINGSNIS)Pakelkite dinozaurą iki viso dydžio.

Ar tikrai galėtume panaudoti šią formulę dinozaurus atkurti? Jei negalime šiandien, ar galime pagrįstai tikėtis, kad mūsų technologija taps pakankamai gera, kad galėtume tai padaryti ateityje?

Pažvelkime į pirmąjį žingsnį. Idėja gauti dinozaurų DNR iš įkandusių vabzdžių, įstrigusių gintare, kilo George'as O. Poinaras devintajame dešimtmetyje. Gintaras yra suakmenėjusi medžių sula. Paprastai jis yra skaidrus su gelsvu atspalviu. Kartais vabzdžiai įstrigo medžio suloje, kol ji nesustingsta. Kai kurie gintarai datuojami iš mezozojaus eros, kai gyveno dinozaurai, ir neįmanoma, kad vabzdžiai, nešantys dinozaurų kraują, gali būti įstrigę gintare. Pirmas žingsnis atrodo gerai, jei norime skirti laiko ir pinigų tinkamų gintaro gabalėlių paieškai.

Gintaras itin naudingas senovės DNR tyrimams. Daugumoje suakmenėjusių kaulų tikroji organinė medžiaga buvo pakeista mineralais. Tačiau gintaras labai ilgai išsaugo minkštuosius gyvūno audinius.

Antras žingsnis – pašalinti iš vabzdžio dinozauro DNR. DNR, dažnai vadinama gyvybės planu, randama daugelyje gyvo kūno ląstelių. Policijos laboratorijos iš tikrųjų ištraukė žmogaus DNR iš šiuolaikinių uodų, kad galėtų panaudoti kaip įrodymą baudžiamosiose bylose. Taigi, nors tai gali būti labai sunku, tai nėra neįmanoma, kad galėtume išgauti kai kurie dino DNR iš baltųjų kraujo kūnelių kraujyje, kurį atgauname iš senovinio uodo (Būtų daug lengviau padaryti, jei gautume DNR iš raudonųjų kraujo kūnelių, nes kraujyje jų yra daug daugiau nei baltųjų kraujo kūnelių, bet deja, raudonieji kraujo kūneliai neturi DNR).

Tačiau po to susiduriame su bėdomis. Mokslininkai jau išskyrė DNR fragmentus iš išnykusio straublio, kuris buvo įstrigęs gintare prieš 120–135 milijonus metų. Atkreipkite dėmesį, kad tai buvo tik a fragmentas straublio DNR (mažiau nei viena milijonoji visos sekos dalis) ir ne kažko kraujas, kurį įkando.

Visas DNR rinkinys turi mėlynus padaro, kurio dalis jis yra, atspaudus. Tačiau šis kodas yra sudarytas iš milijardų atskirų „bazinių porų“ (kaip abėcėlės raidžių), o jų tvarka yra labai svarbi kodui. DNR yra gana trapi ir laikui bėgant suyra. DNR, kurią greičiausiai atgausime iš vabzdžio skrandžio, bus suirusi į mažyčius gabalėlius ir didžiosios jos dalies trūks. Deja, negalime tiesiog pakeisti trūkstamos dalies varlės DNR. Jei tai padarytume, gautume varlės DNR su keliomis mažytėmis dinozaurų sekcijomis, o ne dino DNR su keliomis varlių sekcijomis.

Mokslininkams bus sunku net įsitikinti, kad jie turi dino DNR fragmentą, o ne vabzdžio dalį ar užteršimą iš kažko po tyrėjų nagais. Atminkite, kad niekas anksčiau nematė dinozaurų DNR, todėl mes galime ją identifikuoti tik palyginę ir supriešindami su šiandien gyvų gyvūnų DNR.

Jei ketintume užpildyti trūkstamą dinozaurų DNR dalį, būtų logiškiau pasiskolinti ją iš paukščių, nes atrodo, kad jie yra artimiausi dinozaurui gyvi padarai.

Kai pasiekiame trečią žingsnį, viskas tikrai tampa sudėtinga. DNR dažnai prilyginama programinei įrangai kompiuteryje, nes joje pateikiamos instrukcijos, kaip sukurti gyvą būtybę. (Kadangi kompiuterinės programos instrukcijos gali nurodyti mašinai, kaip sumokėti mokesčius.) Tačiau norint ką nors padaryti kompiuteryje, jums reikia ne tik programinės įrangos, bet ir aparatinės įrangos (paties kompiuterio). Lygiai taip pat mums trūksta „techninės įrangos“, reikalingos DNR vykdyti. Paprastai tai būtų mamytės dinozauras, kuris gamina kiaušinį su jame esančia DNR. Deja, joks senas vištienos kiaušinis to nepadarys. Mums reikia dinozauro kiaušinio. Tikriausiai vienas iš tos pačios rūšies, kurią bandome kopijuoti. Ar galėtume šiuo tikslu pakeisti kažką panašaus į stručio kiaušinį? Galbūt, bet šiandien nežinome, kaip tai padaryti, ar kokių pokyčių reikia.

Darant prielaidą, kad rasime kelią įveikę šią kliūtį, kas bus toliau? Dinozauro perėjimas inkubatoriuje. Su tuo turime daug patirties. Jei kiaušiniai yra geri, tikriausiai galime juos išperinti.

Dabar turime užauginti savo mažylius dinozaurus iki pilnametystės. Padės mūsų patirtis auginant kitas rūšis. Kalifornijos kondorai nelaisvėje buvo auginami naudojant lėles, kurios vaidino tėvų vaidmenis. Taip jie per daug nesusiprato su žmogumi ir buvo lengviau pereiti prie savarankiško gyvenimo gamtoje. Logistika aprūpinti aštuoniasdešimties pėdų ilgio Apatasaurs lėlę šiam tikslui gali būti sudėtinga, bet ne neįveikiama.

Vis dėlto turėtume susirūpinti savo dinozauro sveikata. Kuo mes jį maitiname? Daugelis augalų, kuriuos ji valgė mezozojuje, patys išnyks. Kokie nauji mikrobai išsivystė per pastaruosius 65 milijonus metų, kuriems mūsų dinozauras neturi atsparumo? Kokių vaistų galime duoti savo dinozaurui, jei jis susirgs? Nesant praeities dinozaurų elgesio istorijos, bus sunku pasakyti, ar mūsų dinozauras elgiasi „normaliai“, ar ne.

Net jei niekada negalėsime sukurti dinozauro iš suakmenėjusios DNR, mokslininkai vis tiek gali daug sužinoti apie šiuos padarus ir gyvenimą apskritai, tyrinėdami senovės DNR dalis, kad pamatytų, kaip ji pasikeitė per amžius.

Ir kas žino? Jei įveiksime visas šias kliūtis, galbūt kada nors galėsime sukurti dinozaurą. Tuo tarpu, kol to nepadarysime, turėsime tenkintis žiūrėdami juos filmuose.

Gali pasirodyti, kad gintaras nėra vienintelis galimas dinozaurų DNR šaltinis. Nors daugumoje suakmenėjusių kaulų nebėra jokios biologinės medžiagos, retais atvejais organinė medžiaga išgyveno suakmenėjus. Scottas WoodwardasBrigham Young universiteto mokslininkas pranešė, kad DNR buvo rasta kauluose, paimtuose iš požeminės anglies kasyklos.

Woodwardas žinojo, kad durpynuose rastos skerdenos dažnai buvo gerai išsilaikiusios ilgą laiką. Jis taip pat žinojo, kad senovės pelkės tapo šiuolaikinėmis anglies gyslomis. Gavęs anglies kasykloje rastus kaulų fragmentus Vudvardas nusprendė ieškoti DNR.

Kaip tikėjosi Woodwardas, kaulas nebuvo visiškai suakmenėjęs, o dalys buvo „vaškinės, kaip kietas muilas“. Mikroskopinis kaulo tyrimas parodė, kad ląstelių struktūros vis dar išlikusios, todėl jis pradėjo ieškoti DNR.

Buvo rastas vienas 174 bazinių porų ilgio geno segmentas. Tai neatrodė kaip tas pats genas iš bet kurio gyvo gyvūno, o tai aiškiai rodo, kad tai nebuvo laboratorinio užteršimo rezultatas.

Dinozauro kaulo fragmentas . (Autorių teisės Lee Krystek, 1996)

Nors Woodwardas negali tiksliai pasakyti, kad anglyje rastos kaulų fragmentai buvo iš konkretaus dinozauro, jis žino, kad koks gyvūnas buvo didelis ir gyveno maždaug prieš 80 milijonų metų per Certaceous. Dinozauras atrodo geras kandidatas.

Jei Woodwardas gali parodyti, kad iš tikrųjų turi dinozaurų DNR, jo technika gali būti labai naudinga norint sužinoti daugiau apie išnykusias būtybes. Skirtingai nuo vabzdžių gintare, DNR gavimas tiesiai iš dinozauro kaulo leistų susieti konkrečias DNR sekas su konkrečiomis dinozaurų rūšimis.

Paleontologas Džekas Horneris ir magistrantas Mary Schwietzer jau bandė izoliuotiTiranozauras DNR iš kaulų dar prieš pradedant darbą Woodwardui.

Nors gauti DNR iš dinozaurų yra sunku, atkurti ją iš neseniai išnykusių rūšių gali būti gana lengva. Hendrikui Polinarui iš Miuncheno universiteto pavyko identifikuoti milžinišką tinginį pagal DNR, esančios šio padaro minkštojo kamuoliuko dydžio išmatose. Mėšlas buvo paliktas urve netoli Las Vegaso maždaug prieš 20 000 metų. Tuo metu, kai DNR tapo „karamelizuota“, kai baltymų ir cukraus molekulės susipynė. Tai apsaugojo DNR nuo irimo. Polinaras vėliau sugebėjo suskaidyti ryšius ir perskaityti genetines sekas. Nepaisant išsaugojimo, didelė dalis DNR medžiagos vis tiek buvo prarasta, ir mažai tikėtina, kad šis procesas galėtų būti panaudotas kuriant milžinišką tinginį „Juros periodo parkui“.


Dino-viščiukai ateina

Prieš kelerius metus Bhart-Anjan Bhullar, tuomet daktaro laipsnis. studentas Arhato Abzhanovo laboratorijoje Harvarde padarė kažką neįtikėtino: paėmė embrioninį viščiuką ir jo vystymosi metu slopino keletą genų. Tai buvo nedidelis koregavimas, davęs gana nuostabų rezultatą: „Tos vištos, kurios buvo taip pakeistos, užaugo ir turėjo snukį, kuris atrodė kaip dinozauro snukis“, – pasakoja jis. Atvirkščiai.

Bhullaro tyrimai egzistuoja keistoje molekulinės biologijos ir paleontologijos sankirtoje. Kai jis nedėsto Jeilyje, jis tiria, kaip atsirado pagrindiniai gyvūnų grupių bruožai – šiuo atveju paukščio snapas. Tai gali atrodyti nereikšminga, tačiau suprasti, kaip atsirado paukščio snapas, yra neįtikėtinai svarbu suprasti ne tik šiuolaikinių gyvūnų raidą, bet ir dinozaurus, kurie anksčiau klajojo Žemėje, ir kokie gyvūnai gali toliau klajoti šioje planetoje.

Kad būtų aišku, Bhullar nėra tiksliai bando pakeisti dinozaurą iš vištos. Ir vis dėlto, jo skaičiavimais, po 15 ar 20 metų turėsime visus reikalingus įrankius ir informaciją išperėti gyvą, kvėpuojančią, dino-viščiuką, kuris laksto ir čiumpa grobį savo dantytu snukučiu kaip mažas velociraptorius. „Tai nėra teorinė“, – sako jis. „Aš čia nekalbu apie pusę amžiaus, o apie dešimtmečius. Tai įvyks“.

Paukščiai yra ne tik artimiausi dinozaurų giminaičiai – jie yra dinozaurai. Terminas „dinozauras“ apibrėžia labai didelę gyvūnų grupę, turinčią didžiulę bruožų įvairovę, kurie visi kilę iš bendro protėvio ir valdė pasaulį daugybę milijonų metų. Trumpa istorijos pamoka: Po asteroido smūgio beveik visi jie mirė. Bet ne visi. Kai kuriems dinozaurams – smulkmenoms su sparnais, plunksnomis ir snapais – viskas gerai, ir iš jų, daugiau nei 65 milijonus metų, atsirado 20 000 paukščių rūšių, kurios šiandien vadina Žemės planetą. Jei pavyktų pakankamai toli atsekti viščiuko genetinę kilmę, gautumėte, kad tai labai panašu į mūsų iškasenų ir mūsų vaizduotės dinozaurus.

„Gyvųjų būtybių istorijos paslaptys vis dar yra užrakintos jos paveldėjime, o ypač genome“, - sako Bhullar. Nėra taip, kad visa viščiuko tolimų protėvių genetinė informacija vis dar yra paslėpta jos DNR, bet didelė dalis jos yra arba bent jau gali būti.

Visų pirma, stuburiniai gyvūnai laikui bėgant vystosi labai subtiliai, aiškina Bhullar. „Stuburiniai gyvūnai turi tik tam tikrų anatomijos skirtumų, ir tikriausiai dėl to, kad esame tokie sudėtingi, tokie sudėtingi, kad anksti ką nors sugriovus nebus lengva sukurti gyvybingą gyvį.

Molekulinio išsivystymo lygiu skirtumas tarp paukščio snapo ir dinozauro snukio yra nedidelis – pakanka šiek tiek pakoreguoti tam tikrų genų ekspresiją besivystančiame embrione, kad susidarytų vienas, o ne kitas. Snapas, kaip paaiškėjo, yra labai išaugęs premaxilla - poros mažyčių kauliukų, kurie sėdi pačiame veido priekyje ir kuriuose yra smilkiniai.

Maždaug prieš 85 milijonus metų dinozaurų šeimos medžio šaka iš esmės jau buvo išsiaiškinusi paukščio kūno planą. Tai buvo maži, mėsėdžiai teropodai, giminingi Velociraptor ir tiranozauras. Jie turėjo plunksnas, sparnus, į paukščius panašius kūnus ir į paukščius panašias smegenis. Jie galėjo skristi. Tačiau jie vis tiek turėjo mažus dantytus dinozaurų snukučius. Garsioji Archeopteriksas yra geras pavyzdys.

Tada gana staiga - bent jau geologiniu požiūriu - pasirodė pirmieji snapai. Tie pereinamieji gyvūnai vis dar turėjo dantytus žandikaulius, išskyrus su snapu priekyje, tarsi jis būtų priklijuotas, aiškina Bhullar.

Praėjo milijonai metų, paukščių linijos dinozaurai prarado dantis, o jų žandikaulio kaulai susitraukė iš esmės. Jiems nelieka nieko kito, tik didelį dunkantį snapą. Bet atrodo, kad tas didelis snapas snapas buvo kaip tik tai, ko jiems reikėjo, kad išgyventų apokalipsę.

„Kreidos periodo pabaigoje išliko tie dalykai, kurie galėjo panaudoti tokius maisto šaltinius kaip sėklos, vabzdžiai ir kitos mitybos rūšys, kurios būtų buvusios prieinamos pasaulyje po kataklizmo“, – sako Bhullar. „Ir snapo veikimo būdas leidžia greitai ir tiksliai įsigyti smulkių maisto produktų labai sudėtingame fone. Galite įsivaizduoti, kad vaikščiojate sunaikinto miško griuvėsiais, o ant žemės yra tik akmenukai, pelenai ir visokie mėšlai, ir jūs turite savo „Didžiųjų paukščių akimis“ ir „Didžiųjų paukščių smegenimis“ atsirinkti mažus mažyčius gabaliukus. dalykų, kurie iš tikrųjų yra valgomi“.

Verta paminėti, kad tos kitos į paukščius panašių dinozaurų formos – dantytu snukučiu ir hibridiniu snukučiu/snapu – vis dar buvo šalia ir jiems sekėsi gerai, kai asteroidas išpūtė skylę tiesiai per Žemės plutą. Tačiau nė vienas iš jų nepateko į kitą pusę. „Visi daiktai, kurie neturėjo visiškai modernaus snapo, mirė, ir išliko keletas dalykų, kurie turėjo šiuolaikinį paukščio snapą“, – sako Bhullar.

Kodėl būtent prieš 85 milijonus metų dinozaurai užaugino pirmuosius snapus, sunku pasakyti. Tačiau Bhullaras mano, kad tai susiję su rankomis. Teropodai, tokie kaip velociraptoriai, turėjo ilgas, naguotas dino rankas, kuriomis galėjo paimti grobį. „Tos milžiniškos rankos yra pastoliai, ant kurių buvo pastatytas paukščio sparnas“, – sako jis, ir galiausiai rankos bei pirštai taip pat buvo prarasti dėl efektyvesnio skrydžio.

Bhullar sako, kad būtent tuo evoliuciniu momentu atsirado snapai. Jei kada nors matėte varną savo snapu manipuliuojant įrankiu, nesunku suprasti, kaip tikslus snapo instrumentas gali padėti pakeisti tikslią poros rankų instrumentą.

Klausimas: „Kas yra snapas? yra atspirties taškas norint suprasti, iš kur jie kilę ir kaip molekuliniu lygmeniu genai veikia besivystantį embrioną, kad jį sukurtų. Ir iš ten snapas gali būti atsuktas.

Bhullaras niekada neišperėjo savo viščiukų su snukučiais, nes eksperimento tikslas buvo ištirti vystymosi kelius, o ne išsiaiškinti, ar šie mutantiniai padarai gali išsiperėti, kvėpuoti, valgyti ir vaikščioti. Jie buvo nutraukti, kai jų kaukolės buvo pakankamai išsivysčiusios apvalkale, kad būtų galima patikrinti, ar taip, jų galvos atrodė kaip mažos dinozaurų galvos.

Vis dėlto Bhullar mano, kad jiems viskas būtų gerai. „Viskas atrodė organizuotai, neatrodė labai sujaukta ar deformuota, jie tiesiog buvo transformuoti.

Nereikėtų per daug tokių smulkmenų, kad iš vištienos taptume kažkuo, kas atrodo daug dinozauriškiau, sako jis. Ir šiandien turime technologiją, kad tai padarytume. Vienintelis kliuvinys yra išsiaiškinti, kuriuos mažus genetinio kodo fragmentus reikia pakeisti ir pakeisti.

„Mes kalbame apie esamų išteklių ir esamų išteklių naudojimą, o vienintelis dalykas, kuris iš tikrųjų riboja mus, yra mūsų pagrindinis mokslinis supratimas apie tai, kokios genomo dalys iš tikrųjų kontroliuoja šiuos pokyčius. Jei kas nors ateitų iš ateities ir tiesiog padovanotų mums Word dokumentą (greičiausiai jis turėtų būti tik maždaug dviejų puslapių) su genomo atkarpų, kurias reikia pakeisti tarp aligatoriaus ir paukščio, sąrašu, būtume auksiniai. Galėtume tai padaryti dabar."

Su kuo tiksliai pakeisti tuos skyrius, būtų eksperimentavimo reikalas. Galite naudoti aligatorių arba krokodilą - artimiausius paukščių ir dinozaurų giminaičius. Taip pat galite naudoti kompiuterio programinę įrangą, kad skaitmeniniu būdu atkurtumėte paskutinio bendro paukščių ir krokodilų protėvio genomą ir panaudotumėte jį savo pakaitinei DNR.

Visa tai gali atsitikti dėl naujausios technologijos, vadinamos CRISPR, kuri leidžia labai tiksliai redaguoti genomus įterpiant, pašalinant arba pakeičiant mažus segmentus. Bhullaro teigimu, tai „visiškai transformuojanti, ažiotažas yra tikras – CRISPR yra nuostabus“.

Žinoma, bet štai koks dalykas: nesame toli nuo pasaulio, kuriame galime susintetinti visus genomus nuo nulio. Ir tada viskas taps dar keisčiau. Tas atstatytas genomas bendram paukščio ir krokodilo protėviui? Mes galėtume tai padaryti. Bhullaras šiuo metu dirba ties krokodilo ankstyvojo protėvio fosiliją, kuri atrodo kaip maži sausumoje esantys plėšrūs dinozaurai, sukonstruoti kaip kurtas – tai gali baigtis kažkuo panašiu.

„Arba, naudodami lyginamąją kompiuterinę programinę įrangą, kurią turime genomams žiūrėti, galite pasakyti: „Gerai, pirmiausia atkurkite protėvių formą, bet tada pakelkite ją, kad ji būtų panašesnė į paukščio pusę. Medžio kraštais pakyla link paukščių, o tai iš esmės yra tarsi dinozaurų evoliucija“, – sako jis. „Lažinuosi, kad galų gale gausi mažą, pavyzdžiui, velociraptorių“.

Net jei galėtume susintetinti visus genomus, negalime tiesiog sukurti T. rex, nes neturime jokios išsaugotos dinozauro DNR. Nepaisant ko jūros periodo parkas ar patikėtumėte, genetinė medžiaga nelabai išsilaiko ilgiau nei 65 milijonus metų.

Bet visai neseniai išnykusios būtybės? Mes galėtume juos pagaminti. „Turime nuostabų neandertaliečių genomą. Turime neįtikėtiną mamuto genomą“, – sako Bhullar. „Kažkas neabejotinai sugrąžins neandertaliečius ir tai bus labai įdomu, ir staiga Žemėje atsiras dvi žmonių rūšys.

Akivaizdu, kad etiniai sumetimai tai padaryti yra gana sunkūs, todėl Bhullaras kol kas tenkinasi gyvendamas pagrindinių mokslų pasaulyje, kur besnapių viščiukų embrionams leidžiama vystytis tik tiek, kiek reikia hipotezei patvirtinti. .

„Nenoriu peršokti į tai, bet vis dėlto taip nutiks, atėjo dizainerių organizmų era“, – sako jis. „Labiau norėčiau dirbti savo atradimais pagrįstą darbą ir suprasti pasaulį bei jį keisti didindamas žmonių žinias ir žmonių pasitenkinimą savo gyvenimu, tikiuosi, jų užuojautą ir supratimą, nei norėčiau pakeisti visa tai genetiškai. modifikuoti organizmai“.

„Ateitis bus tikrai įdomi, ir bus daug klausimų, kuriuos žmonės turės užduoti sau, ir daug klausimų, į kuriuos nėra aiškių atsakymų.


Kūrybos tyrimų institutas

Dinozaurų DNR rasti evoliucionistui taip pat neįsivaizduojama, kaip geografui rasti plokščią žemę. Taip yra todėl, kad DNR suyra per greitai, kad truktų milijonus metų. Taigi neseniai paskelbta ataskaita apie galimą dinozaurų DNR žada sutikti pasaulietinių mokslininkų pasipriešinimą. Tačiau kartu su naujais DNR skilimo duomenimis, tai yra stiprus argumentas prieš evoliucinį laiką.

Fosilijos ekspertai ilgą laiką tyrinėjo originalius dinozaurų audinius ir biochemines medžiagas. Kai tiranozaurų ir hadrozaurų kaulus iš Montanos apžiūrėjome pro mikroskopą, buvo nustatyta, kad juose yra šviežiai atrodančių kaulų ląstelių, vadinamų osteocitais. 2009 m. mokslininkai netgi patikrino originalius, ne mineralizuotus ir mdašdinozauro baltymus, vadinamus kolagenu ir elastinu.

Naujas pranešimas žurnale Kaulas nustatė stuburiniams specifinius baltymus, pavadintus aktinu ir PHEX. Taip pat aprašyta DNR dinozaurų ląstelėse. 2

Daugelis pasaulietinių mokslininkų siekė išspręsti greitai irstančių biocheminių medžiagų, randamų giliai fosilijose, dilemą, teigdami, kad bakterijos jas gamino po to, kai įsiskverbė į kaulą kažkada po to, kai padarai buvo katastrofiškai palaidoti. Vienas iš būdų padėti paneigti bakterijų idėją yra rasti tik gyvūninius baltymus.

Tyrėjai taip ir padarė. Jie taip pat pritaikė dvi skirtingas DNR jautrias dėmes osteocitams. Abi dėmės vizualizavo DNR centrinėje vietoje seniai mirusių dinozaurų ląstelėse ir ten, kur turėtų būti ląstelės ir rsquos branduolys.

Jie taip pat pritaikė antikūną, kuris jungiasi prie DNR pakuojančio baltymo, vadinamo histonu H4, bakterijos neturi histono H4, bet turi stuburiniai gyvūnai. Antikūnas surišo savo taikinį, identifikuodamas dar vieną originalų stuburinių baltymų rūšį. Ir histonas sėdėjo tame pačiame į branduolį panašiame centriniame ląstelių regione. Dėmės ir antikūnai nesurišo nei kitų ląstelės dalių, nei dinozaurų fosilijas supančių nuosėdų. Trumpai tariant, šis tyrimas tvirtai patvirtino originalių dinozaurų baltymų ir DNR buvimą.

Dinozaurų ląstelėse tikrai yra DNR, ir ji yra ten, kur būtų galima tikėtis, jei tai būtų originali dinozauro DNR. Nenustačius DNR sekos, sunku būti visiškai tikram. Tačiau mokslininkai pranešė apie senovės DNR iš įvairių fosilijų, įskaitant dinozauro kaulus. 3

Jei tai yra dinozauro DNR, tai negali būti milijonų metų senumo dėl atskiro tyrimo rezultatų. Mokslininkai ištyrė 158 senovinius kojų kaulus iš išnykusio milžiniško moa paukščio, gyvenusio Naujojoje Zelandijoje ir Pietų saloje. Tyrimo autoriai sukūrė DNR skilimo greitį su precedento neturinčiu griežtumu. 4

Moa tyrimų grupė nustatė, kad DNR pusinės eliminacijos laikas yra 521 metai esant vidutinei vietinei temperatūrai. 5 Po šio laiko turėtų likti tik pusė DNR kiekio, esančio gyvūnui nugaišus. Ir po dar 521 metų tik pusė kad lieka, ir taip toliau, kol neliks. Tokiu greičiu DNR molekulės kauluose suyra jau po 10 000 metų į mažyčius cheminius segmentus, per trumpus, kad šiuolaikinės technologijos galėtų sekti. Ir šis rezultatas apima išsaugojimo veiksnius, kurie optimizuoja biocheminį ilgaamžiškumą.

DNR negalėjo trukti pusės milijono metų, tačiau paleontologai DNR aprašo milijonų metų senumo mėginiuose. Atsisakius milijonų metų dogmos, ši dilema būtų išspręsta. Aiškiai aptikti dinozaurų baltymai ir tai, kas atrodo kaip dinozaurų DNR, turi prasmę, jei žemės sluoksniai, kuriuose jie yra, buvo nusodinti Noah&rsquos Flood tik prieš tūkstančius metų.

  1. Schweitzer, M. H. ir kt. 2009. Kampanijos hadrosauro B. Canadensis biomolekulinis apibūdinimas ir baltymų sekos. Mokslas. 324 (5927): 626-631.
  2. Schweitzer, M. H. ir kt. 2013 m. Dinozaurų osteocitų molekulinės analizės patvirtina endogeninių molekulių buvimą. Kaulas. 52 (1): 414-423.
  3. Woodward, S. R., N. J. Weyand ir M. Bunnell. 1994. DNR seka iš kreidos periodo kaulų fragmentų. Mokslas. 266 (5188): 1229-1232.
  4. Allentoft, M. E. ir kt. 2012 m. DNR pusinės eliminacijos laikas kauluose: skilimo kinetikos matavimas 158 senose fosilijose. Karališkosios draugijos darbai B. 279 (1748): 4224-4733.
  5. Tai yra 242 bp moa mitochondrijų DNR srities pusinės eliminacijos laikas, kalibruotas naudojant radioaktyviosios anglies metus iki maždaug kalendorinių metų.

* P. Thomas yra Kūrybos tyrimų instituto mokslo rašytojas.

Cituokite šį straipsnį: Thomas, B. 2013. DNA in Dinosaur Bones? Veiksmai ir faktai. 42 (1): 15.


Štai kodėl mes negalime klonuoti dinozauro, bet galime sukurti vištozaurą

Peržiūrėkite vaizdą visame ekrane
  • komentarai Palikite komentarą
  • facebook Dalintis šiuo elementu Facebook
  • whatsapp Bendrinkite šį elementą per WhatsApp
  • twitter Pasidalinkite šiuo elementu Twitter
  • paštas Siųsti šį puslapį kam nors el. paštu
  • daugiau Dalintis šiuo elementu
  • daugiau Dalintis šiuo elementu

TORONTO – Atidarius jūros periodo pasaulis Šią savaitę visi vėl klausia: „Ar galime klonuoti dinozaurus?”“ Atsakymas paprastas: ne.

Tačiau istorijoje yra daugiau nei tik klonavimas.

DNR — dezoksiribonukleorūgštis — turi visų gyvų būtybių genetinį kodą. The jūros periodo parkas Idėja yra ta, kad senovės uodai valgė dino kraują ir galbūt įstrigo medžio dervoje ir mirs.

Po milijonų metų mes susiduriame su uodų ir dino krauju, o tada genetikai išskiria DNR iš paskutinio uodo valgio ir atstato dinozaurą, kurį suerzino minėtas uodas (ar įsivaizduojate T-rex nusivylimą būtų bandęs užmušti uodą?). Reikalas tas, kad tai tik tai: magija.

Negalima sakyti, kad genetikai nepadarė nuostabių dalykų (pagalvokite: klonavimas apskritai). Tik tai, kad gauti tą dinozauro DNR yra labai sunku.

Mokslininkai iš tikrųjų bandė išskirti DNR iš medžio dervos. 2013 m. Mančesterio universiteto mokslininkų atliktas tyrimas parodė, kad išskiriant DNR iš vabzdžių, išsaugotų kopale (medžio dervoje), kurių amžius buvo nuo 60 iki 10 600 metų, iš pačių vabzdžių visiškai nepavyko gauti DNR.

ŽIŪRĖTI: Albertoje pristatytos naujai atrastos dinozaurų rūšys

Problema ta, kad derva yra labai porėta molekuliniu lygiu, todėl dujos gali patekti į vidų ir iš jos. Bet kuri kažkada egzistavusi DNR būtų visiškai suardyta.

Kalbant apie DNR išgavimą iš fosilijų, mokslininkai teigia, kad tai taip pat neįmanoma, nes DNR neišgyvena fosilizacijos procesų. Iš esmės kaulai virsta akmenimis, organines medžiagas pakeičiant mineralais.

Tačiau tai nesustabdo visuomenės susižavėjimo sugrąžinti šias būtybes iš praeities.

„Kažkas tai apibendrino taip: jie dideli, nuožmi ir išnykę“, – sakė Albertos karališkojo Tyrrelio muziejaus dinozaurų kuratorius Donaldas Hendersonas. “Taigi jie yra pabaisos, kurios tikrai gyveno, bet saugiai toli nuo mūsų.”

Ir jų didžiulis dydis galbūt yra dar viena priežastis.

“Vidutinis dinozauras yra maždaug 10 kartų didesnis nei vidutinis šiandieninis gyvūnas.”

Tačiau ar mokslininkai turėtų bandyti atkurti išnykusius žvėris? Ar jie gali žaisti su ugnimi (ar ne matytas Jūros periodo parkas?)?

„Kai kuriems žmonėms tai yra daug mokslinio mąstymo prigimtis, o tai reiškia, kad jei galite tai padaryti, turėtumėte pabandyti, nes niekada nežinote, kas iš to išeis“, – sakė Hendersonas.

„Aš visada manau, kad dinozaurai buvo išdalyti labai blogai“, – sakė McGill universiteto profesorius ir Kanados stuburinių paleontologijos tyrimų katedros profesorius Hansas Larssonas. “Manau, kad jei nebūtų susidūręs su asteroidu, jie ir šiandien būtų dominuojantys sausumos gyvūnai.”

Dinozauro statyba

Kalbama apie vilnonio mamuto sugrąžinimą, paskutinis iš jų, kaip manoma, išmirė maždaug prieš 4000 metų. Iš 2013 m. Sibire rasto vilnonio mamuto liekanų mokslininkams pavyko išskirti 43 000 metų senumo DNR. Planuojama ją sujungti su dramblio, artimiausio mamuto gyvo giminaičio, DNR.

“Būtų smagu juos sugrąžinti. Tai tokie nuostabūs gyvūnai“, – sakė Hendersonas. “Ar galite įsivaizduoti milžinišką gauruotą dramblį su didžiulėmis iltimis? Tai būtų gana įspūdinga. Galbūt tai yra arčiausiai kada nors sugrąžinti dinozaurus.”

ŽIŪRĖTI: rastas vilnonis mamutas

Bet kaip gauti dinozaurų DNR?

“Idėja rasti originalią, nepažeistą DNR iš išnykusių dinozaurų, tos durys beveik uždarytos.”

Tačiau yra galimybė iš naujo pažadinti dinozaurų bruožus.

Galbūt girdėjote, kad paukščiai yra dinozaurų protėviai. Bet iš tikrųjų jie patys yra dinozaurai.

“Mes žinome, kad paukščiai yra dinozaurai, - sakė Larssonas.

Ir pasirodo, kad vištiena yra arčiausiai dinozauro. Tiesą sakant, taip arti, kad atliekami tyrimai, kuriais siekiama atgaivinti miegančius, senus genetinius bruožus, kad jie atrodytų panašesni į dinozaurus. Jis vadinamas ‘chickenosaurus’ projektu.

“Jei dirbame su vištų embrionais ir vištų genetika, tai su dinozaurų embrionais ir dinozaurų genetika.”

ŽIŪRĖKITE: TED pokalbį “Dinozauro kūrimas iš vištienos”

Genetikai gali manipuliuoti genetiniais bruožais, kad nuslopintų vištos plunksnas arba ataugintų nagus ar žvynus. Kalbant apie dantis, paaiškėja, kad paukščiai negali pagaminti emalio. Jie gali sudaryti dantų pumpurus, bet viskas. Mokslininkai turėtų sukurti transgeninį paukštį, ty paukštį, kurio DNR iš kitos rūšies, pavyzdžiui, pelės.

“Vėl negautumėte pilno velociraptoriaus, bet galbūt gausite kažką, kuriame yra daug mažiau paukščių ir daug daugiau išnykusių dinozaurų, - sakė Larssonas.

“Mes’tikrai nekalbame apie viščiukus, skirtus dinozaurams gaminti. Mes iš tikrųjų sakome, kad tiesiog sukurkime genomą, kad sukurtume tai, kas labai panašu į dinozaurą.”

Yra skirtumas tarp mutuojančių genų ir vėl pažadinančių miegančių bruožų, o tai vadinama atavizmu. O atgaivinti atavistinius bruožus nėra taip paprasta, kaip perjungti jungiklį: genai yra užkoduoti vienas kitame, todėl kai manipuliuojate vienu, tai turės įtakos kitam. Larssonas sakė, kad tai yra nuolatinis išbandymas, norint pamatyti, kokios yra savybės aktyvavimo pasekmės. His lab is working on reactivating the chicken’s ancient tail (it is not allowed to let the embryonic chicken hatch).

View image in full screen

Larsson said that there are practical applications to being able to create something by altering the genomes, such as the work he and other scientists are doing with the chickenosaurus.

“Imagine taking a corn seed and planting it to grow a house. If we could actually engineer the genome in plants to grow shapes that we find useful, like house-shapes, or furniture shapes,” he said. “None of these are impossible, if we could fully understand how the genome works to create complex anatomy. It’s getting really sci-fi.”

So how long before we see the chickenosaurus?

Larsson said that funding for this kind of research is paltry in both Canada and the United States. In a perfect world, with no limit to funding, he estimates that they could make the chickenosaurus within five years. Instead, with the existing funding, it will take his lab the same time just to figure out the chickenosaurus’s tail.

Nors jūros periodo parkas will remain the stuff of science fiction, chin up: there’s still the possibility we’ll create scary-looking monsters developed from chickens.


Understanding the Difference in Cloning and Reverse Engineering

When we are talking about the evolution of dinosaurs, we need not look further than our feathered friends. Birds may not strike the same fear in most that a tyrannosaurus would, but they’re still genetic relatives.

So we have chicken genomes and plenty of DNA to go off of – would it be possible for scientists to manipulate that genetic data and make it closer to a dinosaur than a bird? What if scientists added a long tail, rows of sharp teeth, and more size – would it be a dinosaur?

In terms of looks and functionality, perhaps – it would be as close to a dinosaur as we’ll ever see in the modern age. And even while they have DNA and traits in common, there’s no reason to think it would be the same as cloning a dinosaur.

In that case, it would merely be a creature that was reverse engineered and manipulated to give the appearance of a dinosaur. Because it lacks the true genome of these beasts, it is not the same as being cloned.

Cloning is a tricky concept, especially when we’re dealing with animals that are no longer on the earth anymore. The idea of cloning dinosaurs is possible, but it will require scientists to find the right genetic material.

This is a hard task, as the material is not only in scarce amounts but it is prone to breaking down quickly over time. But the search is on and the goal is in sight.


Atsakymas

Kat - Now it's time to look at your burning genetics questions, with the help of Naked Scientist Martha Henriques.

Martha - This month, listener Steve Cherry from Lethbridge, Alberta in Canada wanted to know how researchers extract dinosaur DNA from fossils and separate it from contaminant DNA from other organisms. Firstly, the bad news is, that no one has yet successfully isolated DNA from dinosaur fossils. Dr. Greger Larson from Durham University told me how DNA is isolated from fresh biological specimens and why doing the same for ancient specimens like dinosaur remnants is so difficult.

Greger - The way that we usually do it is to simply remove everything that isn't DNA and filter it off and that leaves us with the small tube that only has the DNA left in it. Of course, DNA exists in every single living organism, so we can't discriminate between all the different possible sources of DNA. All we can do is isolate DNA from everything that's non-DNA. And once we've got that in a tube then we can start to do all kinds of things including sequencing it or going after specific markers, or amplifying specific places, but the act of isolating it is a relatively straightforward process and we can do it from any number of things including skin cells or feathers or bone, or teeth, or anything that's biological and that is alive or was recently alive, we can isolate DNA from.

Martha - But when it comes to ancient specimens like dinosaur fossils, the chance of success with this method becomes vanishing small.

Greger - As soon as something dies, everything about that thing starts to degrade. So, the analogy would be, the bowl of fruit that you probably have in your kitchen and if you were just to leave that bowl of fruit there for a day or two, it'll be fine, but if you leave it there for a month, it will probably be no longer something that's even remotely appetizing. And if you leave it there for a year, it would be hard to differentiate the different kinds of fruit you had in that bowl a year before and if you leave it there for 20 years, there probably won't be anything even remotely resembling fruit in there and DNA is no different.

The longer that an organism is dead, the more of the DNA degrades and it degrades at a rate which is dependent upon lots of different factors including how long it's been, what temperature it's being stored at, or what sort of other organisms are eating it, or any number of other things. But even in the best case scenario where you have something frozen say, in the tundra where it's very cold, the half-life of DNA is somewhere in the order of maybe 100 or 200,000 years which means, half of the amount of DNA that you start with will be gone after about 100 and 200,000 years.

So, the reason it's difficult to get DNA out of dinosaur bones is simply because there is no DNA left. The same reason that if you were to leave the bowl of fruit on your kitchen table for 65 million years, the chances of you being able to come back and get any fruit out of that would be virtually nil. So, any reports that there's been of dinosaur DNA, they're either not reporting dinosaur DNA or they're reporting other bits of DNA that they've isolated that don't have anything whatsoever to do with that dinosaur bone.

Martha - This contaminant DNA is a problem for all work on ancient biological specimens. Dr. Mim Bower of Cambridge University worked from isolating DNA from prehistoric horse remains preserved in icy environments. These well-preserved specimens are much younger than dinosaur fossils and still have some of their original DNA present. Dr. Bower describes how she distinguishes any contaminant DNA from the horse DNA that she's interested in.

Mim - So, for every sample of bone that we try to extract DNA out of, we also examine a number of controls so that each time I do a DNA extraction, I work with a set number of 6 control reactions which have exactly the same components in except for the bone particle and that helps me control whether there is a DNA coming from me, or from the environment, or from the reagents that I'm using because if I see a positive DNA peak in my control samples which should have nothing in them then I know that I have made an error somewhere and I go back and I start again, and I'd clean everything down. So, we have a very strict contamination protocol nowadays and I have to say that most DNA researchers who are experienced can work very cleanly. And when we don't work cleanly, we can immediately see what has gone wrong and put it right.

Martha - That was Greger Larson from Durham University and Mim Bower from Cambridge University.


Birds are dinosaurs

The recognition that birds are dinosaurs is an idea that has been proven beyond reasonable doubt in the last 20 years, and also gives us new clues on what extinct dinosaurs might have been like.

Sinosauropteryx was the first dinosaur found to have feathers, other than birds and their immediate relatives. It was covered with simple filament-like feathers, which you can see preserved along the back and tail of this fossil. Scientists have even established that this dinosaur's tail had a striped colour pattern. © Sam Ose and Olai Skjaervoy, licensed under CC BY 2.0, via Flickr

As living dinosaurs, birds can be used to test some of the ideas that palaeontologists have proposed based on bones alone. They also carry a direct genetic legacy of their dinosaurian ancestry, which means that bird genes are dinosaur genes, even though birds represent only one specialised branch of the dinosaur family tree.


Kūrybos tyrimų institutas

In church, a friend asked me about the movie Jurassic World. Its high-tech presentation makes the idea of scientists resurrecting dinosaurs from DNA &ldquomined&rdquo from fossils almost seem believable. What parts can we trust, and what parts can we toss?

Good science supports about as many of this movie&rsquos major science-sounding concepts as it does those of recent superhero movies&mdashi.e., very few.

First, the movie&rsquos creators seem to have matched giant sauropods to their sizes known from fossils, but real dinosaurs hatched from small eggs and took several dozen years to get that big. Nobody can accelerate a creature&rsquos growth, and there wasn&rsquot enough time for them to achieve that size. Plus, many other dinosaurs appear much larger in the movie than they ever were when alive.

Much of the movie shows unrealistic technology. Geneticists have made incredible discoveries in the last few decades, but with each new detail they uncover, they find another mind-boggling feature of living creatures. Animal anatomies, genetics, and developmental regimes are so complicated we may never understand them well enough to manipulate them like the fictional geneticists in Jurassic World did. The human body accesses over 200 interactive genes involved in height alone. And many of the genes used during embryonic development perform important separate functions later in life, showcasing the awesome ingenuity of our great Creator. Geneticists would not know where to begin manipulating such a vast network of incredible complexity to produce a new type of creature from living animal genes&mdashlet alone an extinct animal like a dinosaur.

Speaking of which, no scientist has yet brought an extinct creature back to life from just its DNA, much less from isolated and degraded fragments of ancient DNA. It takes a mother to make a baby. It would be amazing indeed to make a machine that mimics all the complicated and wonderful features of a mother&rsquos egg and a mother&rsquos body. The opening scene of Jurassic World shows a dinosaur hatching from an already mature egg. They don&rsquot show how that egg got there&mdashwhere&rsquos the required mother? Scientists cannot craft eggs. The mere shell of a dinosaur egg consisted of precisely interwoven protein fibers and minerals thin enough to permit gas exchange but thick enough to protect the baby dinosaur.

Good science can achieve wonderful feats, but it cannot work miracles or magic. It cannot make a baby out of just DNA.

And what about the idea in Jurassic World that iron plus &ldquohydroxyl&rdquo can cause special chemical reactions that somehow preserve animal tissues&mdashand maybe even DNA&mdashfor millions of years? The scriptwriters needed a scientific-sounding basis for asserting that DNA buried in the earth stayed in good enough shape for geneticists to read its stored information even after that length of time. But this iron rescuing device fails for two reasons. First, although iron discourages bacterial growth, iron plus hydroxyl shreds proteins and DNA. In contrast to the assertions about iron&rsquos preserving power, experiments show it destroys tissues. 1 Second, researchers find few signs of iron or hydroxyls when they uncover bone proteins in fossils. Iron can do amazing things like help transport oxygen and conduct electricity, but it cannot halt or reverse the inevitable chemistry involved in the decay of proteins over time.

Jurassic World packs plenty of pure fiction into a literally unbelievable thriller. Here in the real world, incredibly complicated gene networks reveal the Creator&rsquos masterful mind. This fits with Genesis creation. Also, proteins and DNA found in fossils show that Earth&rsquos sedimentary layers are quite young. This fits the Bible&rsquos timeline. TheJurassic World filmmakers did a nice job making science-sounding concepts appear reasonable, but as usual, real science supports Scripture, not fiction.

  1. &ldquoDue to its strong reactivity with biomolecules, hydroxyl radical is capable of doing more damage to biological systems than any other ROS [reactive oxygen species].&rdquo Prousek, J. 2007. Fenton chemistry in biology and in medicine. Pure & Applied Chemistry. 79 (12): 2325&ndash2338.

Image credit: Copyright © 2015 Jurassic World Universe. Adapted for use in accordance with federal copyright (fair use doctrine) law. Usage by ICR does not imply endorsement of copyright holders.

* Mr. Thomas is Science Writer at the Institute for Creation Research.


Jurassic World science: can we clone dinosaurs?

Genetic engineers are working to restore extinct species to life, but doing so involves solving a massive jigsaw puzzle with missing pieces.

When he visited the George Poinar's lab in the 1980s, author Michael Crichton saw a way to lend plausibility to the plot of his novel-in-progress 'Jurassic Park'. Poinar was working to discover whether amber's ability to preserve the tissues of insects and other tiny creatures could also protect the DNA locked away inside the cells of those tissues.

In a case of life imitating art, Poinar gave samples of amber to his son Hendrik who teamed up with Raul Cano of California Polytechnic. Cano had developed and subsequently patented a process for extracting DNA from organisms trapped in the yellow resin. They extracted fragments of DNA from an ancient, stingless bee and then more extensive samples from a weevil that lived 120 million years ago - almost twice as long ago as the cataclysm that wiped out dinosaur species such as Tyrannosaurus rex.

The paper on the recovery of DNA from the weevil appeared in the journal Gamta a day after the movie's premiere in Washington DC. It seemed that the idea of bringing long-extinct species back to life might be possible, even if they were only insects.

However, attempts to reproduce the original results failed and realisation dawned that the amber samples were hopelessly contaminated &ndash much of it from the DNA of modern bacteria that had either colonised the samples, or had been picked up in the lab itself. The idea of being able to sequence the DNA of a mosquito trapped in amber millions of years ago, let alone any dinosaur DNA rapidly faded.

Ice-age revival?

But the more stringent lab protocols developed by scientists such as Svante Paabo &ndash together with increasingly sophisticated extraction techniques &ndash have yielded usable ancient DNA from other long-extinct species, including our own Neanderthal relatives.

Ice-age species such as these and mammoths show prospects as good as any for revival. It's not just the relative youth of the fossils that helps. Some people want to go ahead and bring them back in the hope of reviving lost ecosystems.

Stewart Brand, president of The Long Now Foundation and the architect of the group's 'Revive and Restore' project, says: "Because it's cold in the Arctic and sub-Arctic, the DNA is relatively intact."

But ice-age DNA is in far worse condition than any DNA that can be extracted from the living. And all but the most recently extinct species yield DNA that is not in the form of whole chromosomes millions of base pairs long. Beth Shapiro, scientist and author of a recently published book on the practicality of de-extinction, describes it as "more like confetti that's been run over by mammoths in the rain".

Paabo says of the experiments conducted on Neanderthal samples: "The DNA fragments are very, very short. Just 50 or 60 bases. And even the best bones result in just 3 or 4 per cent Neanderthal DNA. The rest are from bacteria that colonise the bones."

Even the constituent bases that make up DNA go through chemical changes as the polymer degrades. Cytosine &ndash the 'C' in the familiar four letter 'GTCA' genetic code &ndash is often changed to uracil. In turn, this leads to errors in sequences, because the biological agents that generate multiple copies of a DNA strand to provide sequencing machines with more raw data miscode uracil, inserting a T for thymine rather than a C. Other chemical changes stop the enzyme that creates DNA copies in its tracks, yielding even less information from the highly fragmented chains.

Chemical error correction has made it possible to recover from many of these problems. But there are still problems for de-extinction proponents. Describing the process used to construct what is, for the moment, the best sequence for Neanderthals, Paabo says: "We sequenced a little over a billion fragments from the DNA recovered from the bones. Parts were missing but in the end we had a little over half the total genome."

Not only is a large portion of the DNA missing, there is no way to determine from the DNA itself how it should be structured in a reconstituted genome. Bioinformatics, biology's IT-oriented arm, can deal with some of the problems. Because individual strands of DNA will break down in different ways, there are often overlapping segments. By comparing these segments, computer software can piece together large parts of the molecular jigsaw puzzle of ancient DNA. By comparing the DNA to the genomes of modern species, it often determines whether they are contaminants. But some parts of the genome are currently beyond our reach for another reason.

Shapiro says: "How many genomes have been completely sequenced? None. Not even our own genome, for which a ridiculous amount has been published."

Missing links

Potentially important missing components are lengths of DNA called heterochromatin. The problem for sequencing heterochromatin is that it is highly repetitive and the repeating sequences are very short. There is no practical way for software, using the data that comes from sequencing machines, to determine how many repetitions there should be because overlaps produce little useful additional information.

The role of heterochromatin is fuzzy, but it seems to have a role in regulating when and where genes are active. As regulation of genes is a key factor in the developing embryo, subtle changes to heterochromatin could result in massive modifications to the organism. Without more information on heterochromatin's role, it is impossible to determine what ancient DNA sequences should even begin to look like. But this need not stop the de-extinction process.

Crichton's other plot element used both for biological plausibility and to deliver the novel's warning &ndash weaving together genes from today's species with those from ancient DNA &ndash may provide the template for de-extinctions in the short to medium term. It is likely to make more sense to start with modern DNA and add in the elements needed to reproduce the ancient species, as the heterochromatin and other poorly understood parts of the genome are already in place. Based on the genomes performed so far, the Asian elephant seems to be a closer relative to the mammoth than the African elephant. This has given geneticists hope that relatively simple changes could result in a surrogate mother elephant giving birth to a baby mammoth. "We could have the first mammoth embryo in three years' time," Brand claims.

George Church's group at Harvard University in Boston, which appears to be in the lead in manipulating elephant DNA to be more mammoth-like, has yet to demonstrate in published research that the genes stitched into elephant eggs result in the mammoth DNA being used even in early development.

But Church's team has developed efficient techniques for editing DNA. Conventional genetic engineering by comparison is hit-and-miss. Church's CRISPR technique makes it possible to insert DNA in a specific part of a chromosome in such a way that the organism is unlikely to reject the addition.

Reverse-engineering DNA to find out how it works is likely to be the only way that dinosaurs &ndash or at least animals that resemble them &ndash could possibly be brought back to life. There are other ways to recover lost DNA information than to sequence the fragments recovered from ancient specimens. A multi-university team realised their chances of finding DNA from a group of species that lived in ice-age South America were remote.

Although a group that included Hendrik Poinar managed to extract DNA from ice-age rodents found in Mexico, the region where these ungulates lived was too warm and wet for even well-preserved specimens to not have their DNA destroyed. But proteins that make up hair and other parts of the body are much more robust. Enzymes insert each amino acid in a protein in the order determined by the DNA sequence of the corresponding gene. Find variations in the proteins and you find how those genes differ from those used by other species. This is also one of the approaches being used by Mary Schweitzer of North Carolina State University, who found remnants of soft tissues and collagen in dinosaur bones. Although the sequences show similarity to bird proteins, they may yet be found to be modern contaminants.

There is another approach. Work has started on uncovering the genetic information that birds discarded over the past 65 million years by, in effect, rewinding their genetic clock. Scientists already think dinosaurs were a lot closer to birds than the giant lizards of popular imagination. In the movies, velociraptors are scaly. A number of fossils have turned up since that give clear indications that the animals were feathered and may even have been able to glide over very short distances.

Turn back the clock

The search for a way back has already begun: with hen's teeth. In 2006, scientists from the University of Wisconsin and the University of Manchester succeeded in coaxing the embryos of chickens to grow teeth similar to those found in dinosaur fossils by reactivating latent genes. Other work, based on the intuition that bird embryos briefly grow lizard-like tails before further development causes them to develop as those of birds, points to a number of individual genes lingering from the days of the dinosaurs that may have mutated very little over millennia because they are still required by the growing organism. Similar work by Richard Borowsky at New York University has given eyes back to blind cavefish, a species that has lost the ability to see since the Pleistocene.

Mutations that render the genes entirely inactive would put the animal itself at risk. What has changed is the framework that puts them to use. By working out ways in which these genes can be reactivated and develop more dinosaur-like features, scientists such as Jack Horner &ndash who acted as consultant on the movie of Crichton's novel &ndash believe it might be possible to reconstruct the creatures by engineering modern bird DNA.

But it's far from clear how much new DNA needs to be synthesised in order to recreate features that have been mutated out completely over millions of years. DNA that is not needed by species quickly turns to junk or is co-opted by other mechanisms in the cell if some of the mutations turn out to be beneficial. Simply rewinding the genetic clock and generating dinosaurs by atavistic mutation of chickens to create what might be called an 'alektosaur' is not a realistic option. De-extinction is likely to need new DNA to be created.

Brand says: "I think it's fair to say this century will be largely defined by intersection between the kind of coding [IT programmers] do and the kind of coding that life does."

But even if radical genetic engineering succeeds in constructing something that looks like a dinosaur, it is clear that it can never bring back what existed more than 65 million years ago. The specific information in those genomes has been chemically shredded forever. Such a chimera would have a lot in common with the beast that underpins the plot of Jurassic World. Maybe life can imitate art.

Sign up to the E&T News e-mail to get great stories like this delivered to your inbox every day.


Žiūrėti video įrašą: Dinozauras (Birželis 2022).