Informacija

DNR radimas iš aminorūgščių sekos problema

DNR radimas iš aminorūgščių sekos problema


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Mano bandymas: Pirmiausia paėmiau vienos raidės AA kodus ir padariau juos aminorūgštimis. Taigi, pirmasis yra Trp, kuris yra 5'-UGG-3'. Iš to gavau DNR seką 3'-CCA-5'. Tačiau teisingas atsakymas (rodomas raudonai) neturi šios sekos. Ką aš blogai padariau?


Jūsų būdas išversti AA seką, kodonas po kodono, buvo teisingas. Tai buvo šiek tiek gudrus klausimas, nes norint jį atpažinti, reikėjo perskaityti seką atgal.

UGG-CAA-GGT-CAC ir tt nuskaitoma tiesiai iš 3'->5' atsakymo, apibrėžto apskritimu, juostos, skaitoma iš dešinės į kairę.

Apačioje kairėje yra raudonoji silkė, nes ji prasideda pradžios kodonu ATG, tačiau skaitant už pradžios kodono seka nesutaptų.


Išverskite mRNR į atitinkamas aminorūgštis.

mRNR transkribuoja DNR. Tai reiškia, kad jame yra DNR informacija arba instrukcijos, kurios nustato, kokį baltymą reikia gaminti. Štai kodėl ji vadinama pasiuntinio RNR, nes perduoda žinią į baltymų gamybos vietą – ribosomas.

tRNR taip pat žinoma kaip perdavimo RNR. Jis perkelia aminorūgštis į mRNR šabloną. Jis veikia kaip adapteris, verčiantis RNR seką, ir jie neša aminorūgštį.

Transkripcijos metu DNR duoda nurodymus mRNR ir transkribuoja ją tam tikru kodu, susiejančiu su konkrečia aminorūgštimi. Tai įvyksta branduolyje. Kai transkripcija atliekama, ji pašalinama iš branduolio ir patenka į citoplazmą. Tada šis perrašytas pranešimas nunešamas į ribosomą, kur jis liks, kad būtų paverstas aminorūgštimis.

Transliacijos metu DNR kodas, kuris buvo perrašytas į mRNR kodą, bus ribosomoje, kur tRNR atneš savo nešamą aminorūgštį, būdingą mRNR sekos sekai. tRNR linija, būdinga sekai, ir aminorūgštys, kurias jos turi, susijungs į tam tikrą grandinę ir kartu sukurs baltymą.

DNR naudojama baltymams gaminti pagal jos turimą kodą. Kad ir kokie būtų mRNR transcibai iš DNR, taigi, net jei RNR gamina baltymus, ji bus pagrįsta pateikta DNR seka.

Kurdami DNR papildomą grandinę pradinei grandinei, tereikia atsiminti bazių poras:

Tai žinoma kaip Chargaffo taisyklė.

Taigi paimkite savo pirmosios krypties pavyzdį:

Tačiau kalbant apie RNR, RNR nėra timino. Taigi vietoj timino naudojamas Uracilis. Tada bazinės poros būtų:

Vėlgi, imkime tavo pavyzdį:

Transkripcija: AUG AAC CAU UCA

Transliacijos metu aminorūgštys koduoja specifinius kodonus arba 3 bazių grupes. Jums pateikta diagrama rodo, ką kiekvienas kodonas koduoja.


DNR surišančių likučių baltymuose numatymas iš aminorūgščių sekų, naudojant atsitiktinį miško modelį su hibridine funkcija

Motyvacija: Šiame darbe mes siekiame sukurti skaičiavimo metodą, leidžiantį nuspėti DNR surišimo vietas baltymuose iš aminorūgščių sekų. Siekiant išvengti pernelyg didelio pritaikymo naudojant šį metodą, modeliams kurti naudojami visi turimi DNR surišantys baltymai iš Baltymų duomenų banko (PDB). Atsitiktinio miško (RF) algoritmas naudojamas, nes jis yra greitas ir turi tvirtą našumą skirtingoms parametrų reikšmėms. Pristatoma nauja hibridinė savybė, apimanti aminorūgščių sekos evoliucinę informaciją, antrinės struktūros (SS) informaciją ir ortogoninio dvejetainio vektoriaus (OBV) informaciją, atspindinčią 20 rūšių aminorūgščių charakteristikas dėl dviejų fizikinių ir cheminių savybių (dipolių ir tūrių). šoninių grandinių). Surišančių ir nesurišančių likučių skaičius baltymuose yra labai nesubalansuotas, todėl siūloma nauja schema, kaip išspręsti nesubalansuotų duomenų rinkinių problemą sumažinant daugumos klasę.

Rezultatai: Rezultatai rodo, kad RF modelis pasiekia 91,41% bendrą tikslumą, kai Matthew koreliacijos koeficientas yra 0,70, o plotas po imtuvo veikimo charakteristikos kreive (AUC) yra 0,913. Mūsų žiniomis, RF metodas, naudojant hibridinę funkciją, šiuo metu yra optimalus skaičiavimo metodas, leidžiantis nuspėti DNR surišimo vietas baltymuose iš aminorūgščių sekų, nenaudojant trimatės (3D) struktūrinės informacijos. Mes parodėme, kad prognozavimo rezultatai yra naudingi norint suprasti baltymų ir DNR sąveiką.

Prieinamumas: DBindR žiniatinklio serverio diegimas yra laisvai prieinamas adresu http://www.cbi.seu.edu.cn/DBindR/DBindR.htm.

Figūros

Tikėtinas prognozės tikslumas ir…

Numatomas prognozavimo tikslumas ir sekų dalis su kiekvienu RI pagal…

ROC grafikų našumo palyginimai…

ROC grafikų našumo palyginimas su kitais metodais. ( A ) Abu klasifikatoriai…


Papildomi duomenų failai

Šiuos papildomus duomenis galima rasti internetinėje šio dokumento versijoje. 1 papildomų duomenų failas yra žmogaus ThyA baltymo muzikinis klipas, pagrįstas vienos aminorūgšties vienai natai priskyrimu. 2 papildomų duomenų failas yra žmogaus ThyA baltymo, gauto iš sumažintos 13 bazių natos akordo priskyrimo, muzikinis klipas. 3 papildomų duomenų failas yra žmogaus ThyA baltymo muzikinis klipas, pagrįstas mūsų galutine kodavimo užduotimi, apimančia ritmą. 4 papildomų duomenų failas yra huntingtino baltymo muzikinis klipas, pagrįstas mūsų galutine kodavimo užduotimi.


Atraskite koduojančią aminorūgštį, kai DNR sekoje yra tam tikras modelis

Norėčiau gauti koduojančią aminorūgštį, kai DNR sekoje yra tam tikras modelis. Pavyzdžiui, modelis gali būti toks: ATAGTA. Taigi, kai turite:

Ideali išvestis būtų lentelė, kurioje kiekviena aminorūgštis užkoduota pagal šabloną. Čia 1 sekoje modelis koduoja tik vieną aminorūgštį, o sekoje 2 – dvi. Norėčiau, kad šis įrankis veiktų, kad būtų galima pritaikyti tūkstančius sekų. Aš galvojau, kaip tai padaryti, bet galvojau tik: pakeisti visus nukleotidus, kurie skiriasi nuo modelio, išversti tai, kas liko, ir gauti koduotų aminorūgščių suvestinę.

Praneškite man, ar šią užduotį galima atlikti naudojant jau turimą įrankį.

Ačiū už jūsų pagalbą. Viso geriausio, Bernardai

Redaguoti (dėl mano įrašo sukeltos painiavos):

Pamirškite originalų įrašą ir seką1 bei seką2.

Sveiki visi ir atsiprašau už sumaištį. Įvesties „fasta“ failas yra *.ffn failas, gautas iš „GenBank“ failo naudojant „FeatureExtract“ įrankį (http://www.cbs.dtu.dk/services/FeatureExtract/download.php), todėl galite įsivaizduoti, kad jie jau yra kadras (+1) ir nereikia gauti aminorūgščių, koduotų kitame nei +1 kadre.

Norėčiau sužinoti, kurią aminorūgštį koduoja šios sekos:

Unikalios eilutės, kurias noriu gauti koduojančias aminorūgštis, yra trijų AG, GA, CT arba TC, tai yra (AG)3, (GA)3, (CT)3 ir (TC)3, pasikartojimai. Nenoriu, kad programa nuskaitytų koduojančias aminorūgštis keturių ar daugiau kartojimui.


DNR radimas iš aminorūgščių sekos problemos – Biologija

Genetinis kodas naudojamas iš mRNR paversti baltymu. Kiekvienas trijų raidžių kodonas koduoja arba aminorūgštį, arba liepia ribosomai sustabdyti vertimą. Kodonas skaitomas 5–3 kryptimis. Pavyzdžiui, UGG koduoja Trp (triptofaną).

1. Atsižvelgdami į šią DNR sekos juslinę grandinę, perrašykite ją į mRNR, parodydami mRNR orientaciją [t.y. 3' ir 5' galai]. Tada išverskite šią seką į baltymą [nurodant amino ir karboksi galus, būtinai patikrinkite, ar nėra atviro skaitymo rėmelio.]

5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCCGGA 3

2. Jūs ką tik sekvenavote trumpą DNR segmentą. Norite išanalizuoti šią DNR seką, kad nustatytumėte, ar ji gali koduoti baltymą.

5' TCAATGTAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATCCACT 3'

1. Raskite ilgiausią atvirą skaitymo rėmelį (ORF). Atminkite, kad yra šešios galimybės.

2. Pažymėkite, kuri DNR grandinė bus sensorinė, o kuri bus antisensinė, kai ši DNR bus transkribuota.

3. Perrašykite šį ORF į mRNR, nurodydami 5' ir 3' galus.

4. Išverskite šią mRNR į aminorūgštis, nurodydami amino (N) ir karboksi (C) galus.


DNR radimas iš aminorūgščių sekos problemos – Biologija

Atlikdami toliau pateiktą pratimą, jums bus suteikta nežinoma DNR seka ir bus paprašyta naudoti žiniatinklio įrankį sekai paversti aminorūgščių seka ir, tikėkimės, nustatyti tinkamą skaitymo rėmelį. Tada šią aminorūgščių seką išsaugosite teksto apdorojimo programoje (arba išsiųsite ją el. paštu sau), jei norite ją panaudoti kitame pratime.

Jūsų sekos gavimas
Laboratorijoje tai galima gauti nustatant klono seką iš cDNR bibliotekos arba išskiriant amplifikuotą DNR fragmentą iš PGR amplifikacijos. Dažnai sekdami tokį produktą pastebime, kad turime netikėtą DNR fragmentą, kurį turime išanalizuoti. Čia atsitiktinai pateiksime dalinę seką iš savo sekų duomenų bazės. Kai spustelėsite mygtuką Gauti geno seką, žemiau esančiame lange pasirodys dalinė nukleotidų seka.

Sekos vertimas
Kelios žiniatinklio svetainės atlieka įvesties sekos vertimą. Spustelėjus toliau esančią nuorodą „Expasy“, atsidarys naujas langas, suteikiantis prieigą prie vertimo įrankio. DNR seka verčiama vienu metu nuskaitant nukleotidų seką po tris bazes, o tada žiūrint į genetinio kodo lentelę, kad gautumėte aminorūgščių seką. Ši programa tiria įvesties seką visuose šešiuose galimuose kadruose (t. y. nuskaito seką nuo 5' iki 3' ir nuo 3' iki 5', pradedant nuo nt 1, nt 2 ir nt 3). Mes paprastai ieškome, norėdami nustatyti tinkamą vertimą, tai kadras, kuris suteikia ilgiausią aminorūgščių seką prieš sutinkant stop kodoną. (Kadangi yra 64 kodonai ir trys nesąmonių kodai, mes tikimės, kad stopkodonas atsiras vidutiniškai kartą per 20 aminorūgščių, jei tiesiog perskaitysime seką „ne kadro“. Tačiau „vidutiniškai“ yra būtent tai, ir ji yra įmanoma, kad neteisingas skaitymo rėmelis pateiktų išplėstinę seką be stop kodonų. Kitas pratimas padės išspręsti šią problemą.

Vertimui naudosime Expasy įrankius. Spustelėjus jį, atsidarys naujas langas, kad galėtumėte grįžti į šį langą, kad gautumėte instrukcijas ir nukopijuotumėte seką.


REZULTATAI

1 lentelėje parodytas SVM klasifikatorių veikimas 5 kartus kryžminiu patvirtinimu. Rezultatai gauti naudojant treniruočių parametrus, C = 0,5 ir γ = 0,1, o tai duoda geresnius rezultatus nei kitos vertės numatant DNR ir RNR surišančius likučius. DNR surišančių likučių klasifikatorius pasiekia 70,31% bendrą tikslumą, 69,40% jautrumą ir 70,47% specifiškumą. RNR surišančių likučių atveju galima prognozuoti 69,32 % bendru tikslumu, 66,28 % jautrumu ir 69,84 % specifiškumu (1 lentelė).

ROC kreivės, skirtos DNR ir RNR surišančių liekanų prognozei, parodytos 1 paveiksle. Šios ROC kreivės buvo sukurtos keičiant SVM klasifikatorių išvesties slenkstį ir kiekvienos slenkstinės reikšmės tikrojo teigiamo ir klaidingai teigiamo dažnio diagramoje. Numatytasis SVMlight naudojamas išvesties slenkstis yra 0, todėl visi išėjimai ≥ 0 lemia teigiamus prognozes, o išėjimai <0 – neigiamas prognozes. Kai naudojami aukštesni slenksčiai, tik tie duomenų egzemplioriai, kurių išvesties reikšmės yra santykinai didesnės, prognozuojami kaip teigiami, todėl tikrasis teigiamas rodiklis (jautrumas) tampa mažesnis. Tuo tarpu, esant aukštesnėms slenksčiams, specifiškumas tampa didesnis, tačiau klaidingai teigiamų rezultatų rodiklis (1 − specifiškumas) sumažėja. Todėl kiekvienas ROC kreivės taškas reiškia kompromisą tarp jautrumo ir specifiškumo. 1 paveiksle parodytas ROC kreives naudoja BindN žiniatinklio serveris, kad vartotojai galėtų nurodyti norimą specifiškumo ar jautrumo lygį (žr. toliau).

ROC analizė rodo, kad DNR surišančių likučių klasifikatorius yra šiek tiek tikslesnis nei RNR surišančių likučių klasifikatorius, išskyrus labai mažus klaidingai teigiamus rodiklius (1 pav.). AUC reikšmės yra atitinkamai 0,7524 ir 0,7308 DNR ir RNR surišančių liekanų prognozei (1 lentelė). Šios AUC reikšmės yra žymiai didesnės nei atsitiktinai spėjus (0,5).

Atrodo, kad DNR surišančių likučių SVM klasifikatorius yra geresnis nei ankstesni neuroninio tinklo prognozuotojai, sukurti naudojant tą patį duomenų rinkinį (PDNA-62). SVM jautrumo ir specifiškumo vidurkis yra 69,94%, o neuroninio tinklo, apmokyto naudojant sekos informaciją ir tirpiklio likučių prieinamumą, vidurkis (dar vadinamas „grynuoju numatymu“) buvo 61,1% (8). PSSM pagrįstas metodas pagerino „grynąjį numatymą“ iki 67,1 % (11), tačiau prireikė intensyvaus skaičiavimo, norint išgauti ypatybes. Priešingai, mūsų metodu naudojamos trys sekos funkcijos yra labai veiksmingos apskaičiuoti, todėl puikiai tinka internetinėms prognozėms.

Norint tiesiogiai palyginti SVM ir neuroninio tinklo klasifikatorius, iš PDB turimų baltymų ir DNR kompleksų buvo surinktas atskiras bandymo duomenų rinkinys. Kaip nurodyta 3 papildomoje lentelėje, bandymo duomenų rinkinyje yra 92 aminorūgščių sekos. Šios sekos rodo <30% tapatumą tarp jų ir su bet kokiomis sekomis PDNA-62 duomenų rinkinyje. Išskyrus pirmiau nurodytus apribojimus, bandomasis duomenų rinkinys buvo apdorotas taip pat, kaip aprašyta PRINR25 duomenų rinkiniui. Numatytos DNR surišančios liekanos, naudojant tiek BindN, tiek DBS-PSSM. DBS-PSSM žiniatinklio serveris, kurį galima rasti adresu http://www.netasa.org/dbs-pssm/, buvo sukurtas naudojant PSSM pagrįstą neuroninio tinklo metodą (11). Prognozės buvo padarytos su numatomu 72,3% specifiškumu, kuris leidžiamas DBS-PSSM serveryje (DBS-PSSM neleidžia vartotojams nurodyti norimų specifiškumo lygių). Kaip parodyta 2 lentelėje, faktiniai dviejų serverių specifiškumo lygiai yra artimi numatomai vertei. Tačiau BindN pasiekia daug didesnį jautrumo lygį nei DBS-PSSM (65,22, palyginti su 36,73%). Nors BindN pasiektas specifiškumas (65,22 %) yra artimas laukiamai vertei, pagrįstai ROC analize (67,19 %), tikrasis DBS-PSSM specifiškumas nepasiekia laukiamo lygio (60,2 %) naujajame bandymo duomenų rinkinyje, tikriausiai dėl prasto reprezentatyvių DNR surišančių liekanų apibendrinimo santykinai mažame mokymo duomenų rinkinyje (PDNA-62).

SVM klasifikatoriai buvo sukurti naudojant žinomus DNR arba RNR surišančius baltymus. Likučiai, kurie nesijungia su DNR ar RNR, buvo naudojami kaip neigiami treniruočių duomenų pavyzdžiai. Norėdami toliau įvertinti SVM klasifikatorius, išanalizavome 100 baltymų, kurie nesąveikauja su DNR ar RNR, rinkinį. 4 papildomoje lentelėje išvardytos baltymų sekos buvo atsitiktinai parinktos iš Swiss-Prot duomenų bazės (//www.expasy.org/sprot/). Kai šios sekos analizuojamos naudojant BindN, kurio numatomas specifiškumas yra 80 % (numatytoji vertė), faktinis specifiškumo lygis, pasiektas naudojant SVM klasifikatorius, yra atitinkamai 81,58 ir 80,86 % analizuojant DNR ir RNR surišančius likučius. Rezultatai rodo, kad BindN yra patikimas norint pasiekti vartotojo apibrėžtą įvairių baltymų specifiškumo lygį. Taigi numanomi DNR arba RNR surišantys baltymai su neapibūdintais funkciniais domenais gali būti naudojami kaip BindN įvestis. Jei numatytų surišimo likučių skaičius yra žymiai didesnis nei numatomas klaidingų teigiamų rezultatų skaičius, prognozavimo rezultatai gali būti naudojami eksperimentiniam šių baltymų apibūdinimui.

Norėdami parodyti, kad BindN gali suteikti naudingos informacijos norint suprasti baltymų ir nukleorūgščių sąveiką, mes ištyrėme numatomas surišimo liekanas trimačių struktūrų kontekste. 2 paveiksle parodyti du reprezentatyvūs rezultatų pavyzdžiai. 2a paveiksle tariamos DNR surišimo liekanos, kurias BindN prognozuoja pelės ETS-1 transkripcijos faktoriui, yra patikrintos naudojant turimus struktūrinius duomenis (PDB ID: 1K79). Struktūrą sudaro 331–440 ETS-1 baltymo liekanos, kurios nebuvo naudojamos SVM klasifikatoriaus mokymui. Vienintelis homologas PDNA-62 duomenų rinkinyje yra PU.1 DNR surišantis domenas (PDB ID: 1PUE), kurio sekos tapatumas su ETS-1 peptidu yra 28 %. Kaip parodyta 2a paveiksle, 10 iš 16 DNR surišančių liekanų (62,50 %) yra nuspėjamos teisingai pagal aminorūgščių sekos duomenis. Šie tikri teigiami dalykai yra paryškinti raudonai. Mėlynos spalvos likučiai yra šeši klaidingi neigiami likučiai (DNR surišantys likučiai, bet prognozuojami kaip neigiami). Iš 88 neprisirišančių likučių 79 arba 89,77% prognozuojami teisingai (likučiai yra žaliai), o tai gerai atitinka pageidaujamą 90% specifiškumo lygį. Nepaisant to, devyni iš neprisirišančių likučių prognozuojami neteisingai (klaidingai teigiami geltonai). 2b paveiksle tiriamos spėjamos RNR surišančios liekanos, numatytos archealiniam baltymui L7Ae (dėžutės C/D RNR surišimo domenas). Struktūros B grandinė (PDB ID: 1RLG) nėra įtraukta į PRINR25 duomenų rinkinį, bet rodo 34% sekos tapatumą su mokymo duomenimis, 1E7K_A (žmogaus spliceosominis 15,5 KDa baltymas). Teisingai prognozuojamos 6 iš 13 RNR surišančių liekanų (46,15 %) ir 96 iš 104 neprisijungiančių liekanų (92,31 %). Todėl BindN prognozės gali suteikti naudingos informacijos norint suprasti baltymų ir nukleorūgščių sąveiką. Tokia informacija gali būti naudojama vadovaujantis eksperimentiniais tyrimais, tokiais kaip vietinė mutagenezė, skirta DNR arba RNR surišančių baltymų funkciniam apibūdinimui.


3 paprastos taisyklės, kaip be klaidų nustatyti aminorūgščių grandinę iš DNR gabalo!

PIRMA TAISYKLĖ: Atidžiai stebėkite dvigrandės DNR duotąją dalį. Nurodykite transkribuotą grandinę (šabloną) ir netranskribuotą grandinę. Užrašykite juos ant savo knygų, nurodydami kiekvieno pavadinimą. Pabandykite kas 3 raides atskirti brūkšneliu (nes kas 3 nukleotidai reiškia vieną kodoną ir koduos tik VIENĄ aminorūgštį).

Transkribuota / šabloninė DNR grandinė:

TAC – TGC- CTA- GTC- GGC- GTT- CGC- CTT- AAC – CGC TGT-ATT.

Netranskribuota DNR kryptis:

ATG–ACG–GAT- CAG–CCG–CAA–GCG–GAA–TTG–GCG–ACA-TAA.

ANTRA TAISYKLĖ: Parašykite m-RNR taip, kad ji papildytų transkribuotą DNR grandinę. (A iš m-RNR jungiasi su T DNR U iš m-RNR jungiasi su A DNR).

A U G–ACG–GA U – CAG–CCG–CAA–GCG–GAA– UU G–GCG–ACA- U AA.

Pastaba: Norėdami patikrinti m-RNR teisingą seką, tiesiog palyginkite ją su netranskribuota DNR grandine, jos seka turėtų būti tokia pati, bet vietoj T & m-RNR turės U.

Netranskribuota DNR grandinė:

A T G-ACG- GA T – CAG- CCG- CAA- GCG-GAA- TT G-GCG-ACA- T AA.

TREČIA TAISYKLĖ: Naudokite genetinį kodą, kad nustatytumėte teisingą aminorūgščių seką grandinėje, koduojamoje m-RNR.

Šis genetinis kodas yra tarsi žodynas, verčiantis dvi kalbas: m-RNR į aminorūgščių kalbą. Taigi tai, ką matote kairėje, yra m-RNR kodas (trys raidės), o dešinėje - simbolinis aminorūgšties pavadinimas. Viskas, ką jums reikia padaryti, tai sekti raidžių (RNR kodonų) padėtis ant stalo ir rasti aminorūgšties atitikmenį.

AUG–ACG–GAU- CAG–CCG–CAA–GCG–GAA–UUG–GCG–ACA-UAA.

Met – Thr – Asp- Gln – Pro- Gln – Ala – Glu – Leu – Ala – Thr – .

Pastaba: Paprastai susintetinta aminorūgščių grandinė prasideda metioninu (Met), o paskutinis kodonas m-RNR yra stop kodonas, kuris nekoduoja jokios aminorūgšties. (Aminorūgščių skaičius paprastai yra vienu mažesnis nei m-RNR kodonų skaičius)